FC868985

Overview
NameFC868985
Unique NameFC868985
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length713
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31007C08EF AbioticL1 Citrus clementina cDNA clone C31007C08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC868985 ID=FC868985; Name=FC868985; organism=Citrus clementina; type=EST; length=713bp
AAAAAAAATTCAGATCCACTATGGATAGAGAACAAGAAGAGATGCAATTT
TTAGGCATCTTTGGGATATACAGAGAAGCCTGCAAGGTCATCATCACATG
GAGACGAATCTTCAGCAAAATCACGCTAGCCTTAATCCTGCCTCTATCAT
TCATCTTCCTTGCCCACGTTGAACTGACGGATCTCCTTCACAGGAAAGTC
GTCCACGACAAGATGGAACGGCACTTTACTCCAGCCGGCTCCGCTAGATT
CAACAAACTCACCGACGTCATCTCCGAAGACCGAACCTTGTATTGGTTCT
TTAAAGTCGCTTACTTAACCTTCTACCTAGTCTTATCTCTATTATCAACC
TCGGCTGTTGTTTACACCGTTGCGTGTGTTTACACCGGCAAAGATGTTTC
TTTCAAGAAGGTCATGAGCGTGGTGCCAAAAGTTTGGAAGAGGCTAATGG
TCACATTTTTGTGTACCTTTCTCGCATACTTCCTGTACAACTTCGCTGCA
ATCGTGGTAGTCAGCTTGTGGGTCGTCTTATGGGGGATTTTAACAGCTGG
CGGGGATATAAAATTCATGCTCTCAATTCTTTATGTCATATTAGTTTTCT
ACGTAGCGGGGCATTTTTATCTGTCCCGTATATGGCATTTGGCTAGCGTT
GTGTCCGTGTTGGAAGAATCTTGCGGATTCGCAGCCATGATCAAGAGTCA
AGCGTGATTAAGG
back to top