FC869026

Overview
NameFC869026
Unique NameFC869026
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length712
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC31007G02EF AbioticL1 Citrus clementina cDNA clone C31007G02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC869026 ID=FC869026; Name=FC869026; organism=Citrus clementina; type=EST; length=712bp
ATTCAATAAGTAGCCCTCGCAGCACAAAAAATGATTTTCCTACTACTCCT
CTCCGTTTTTCTTCGCGGAGCTTCTTCATCAATCCTTTCCGAAGACACAC
CTATTAGCTTCTCATTTCCCTCATTCGCCAAAGACAGTTGTGACAATAAG
ACCCTCATTTGCTACGGAGCGATTGAAAGTTCCGGCGCCTTAAGCATCAC
ACCAGGCCCTCCACCAAACCTGCCGATCAGAAAGGTTGGACGGGTTTTAT
ACGGCAAGCCTCTGAGTTTACAGCGATCTTTTATTGATACCACCATCACC
ATTAAGATCTCACGCCATCAGAATTACACTGATCGTGCCGGAGATGGCAT
GACGTTCATTTTTGCAAGCGATAAAAACGGTCCATCAGCAAAGGGCGTCG
GCGAATATCTTGGACTGCAGTCTTCACCAGGCGATAAATTTCCTCCATTA
GCCGTGGAGCTGGACACATGCCTGAACAAGAACCTGAATGATCCAGATGA
TAACCATATTGGCATCGACATAAACGGAATCGAATCAAATCCAGTTAATA
GTCTGCTTGACGTTGATCTCAAAAGTGGACGAGCAATCCAGGTTCGAATT
TATTACAATCCAGACTTTGGACAACTCTCTGTTTATGCGGCATATTCGGG
GGAAACACTTGTGAAGGTGGTTGAAAAACCCATTAACCTGTCAGATATAA
TTCCACGCCCGT
back to top