FC869042

Overview
NameFC869042
Unique NameFC869042
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length699
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC869042_ssr154 microsatellite FC869042_ssr154:154..171. BLAST: Citrus ESTs to Prunus persica proteins V1
FC869042_ssr176 microsatellite FC869042_ssr176:176..193. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig9451 contig Ccv1_Contig9451:1..699. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31007H06EF AbioticL1 Citrus clementina cDNA clone C31007H06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC869042 ID=FC869042|Name=FC869042|organism=Citrus clementina|type=EST|length=699bp
GAGAAGCCAGAATTTCGAAATCTCACACATTGCACAAGAAGGAAGAAGAA
AGAATCCATCCAAGATATCCCCAATTCATTGTCAGAAATAAAAATCAGTG
TCCTCTTGCCTCTGGTAATATCACTCCGTGTGAACCCACCAATTCACCAA
ACCCTCTCTCTCTCTCTCTCTCGCACTCTCTCTCTCTCTCTCTCGCACTA
TATAAGCAGAGAAAACCAGGCAACTTTAATTCATTCACAGGCTTTATTAG
CTGTTTGATTGTGTCTTAACCCAGAATCCAAAATGGGTTTTGGTTCCCAC
GTTTTGCTCTTTTGGTTATTCCAATTTGTGCTTTTGTCATCAATGTTGCT
AAAAGAAGCAGAAGCTGAGCAGCACTTGTATAATGTGACCAGCTTGAGAG
GGAGAAAGCAAGTGAGTGGGTGCAATTTGTTTCAAGGGAGATGGGTGATA
GACCCTTCATACCCACTCTACGATTCATCATCTTGCCCTTTCATTGATGC
TGAGTTTGATTGCCTCAAATATGGCAGGCCTGATAAGCAGTACCTCAAGT
ACTCTTGGCAACCTGCCTCTTGTGCCGTACCCAGGTTTGATGGTGGGGAT
TTTCTGAGGAGATATAGAGGGAAAAGGATAATGTTTGTGGGGGACTCACT
GAGTTTGAATATGTGGGAATCGTTGTCGTGTATGATTCACGCGTCGGTG
back to top