FC869047

Overview
NameFC869047
Unique NameFC869047
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length687
Libraries
Library NameType
AbioticL1cdna_library
Properties
Property NameValue
Genbank descriptionC31007H11EF AbioticL1 Citrus clementina cDNA clone C31007H11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC869047 ID=FC869047|Name=FC869047|organism=Citrus clementina|type=EST|length=687bp
GGCAGATGAACAACAAGACTTTCCAACAATTTCTTCACGGAACTTCCATG
TTGATTGTTGAAATATATGGCTAACAAGATGATTCTTGGCTTCTTATTAC
TCAATTTTTGTTGGGTTAAAAAAATCTAAAACAAAACACGGCTATTAGAT
ATCTAACGTTGCTTGCATATGCGCTTTGGTTTCCGGTGACAGAAGCTTTG
GCAATTATATATTTGAAGTCTTCCATATCATTGGTTACTTGCAGCAGGCT
GCAGTAAAATGAACTAAATATGATAGGCCAGATGCAGAAACTTTTTATCT
CCAAAGGCAAATGCTATAGTTGCTGCAATTTTCTGGTTATGTCATGTAGT
CATAAGGTTAGTTTTCTCCTAAATAAATGAACTAAACTAAATAAAAAATA
AGTCATTCCATTCTTTGTAAATGCATTTTCTGCTTGTGCTCATAGAATTG
TTCTAATGCTGGTGATCAGTACAGTAATTATTCGTCTTGCTATGTTCGTT
ATGATACATAATCAGATATATATAAGAGGTCGGCTTTTATAGGGAAGAGT
TTAGTTATCAAGATAATAGTAACTGGAAGCTGATTACAGACTTGACACTG
TTACTAGAGTAAGCACCAGAGAGCATTTAGAGACAGAAAAGTTTTTAGTA
CTCAAATAACATTGGAAGGCGCCCTTGGGGTAAGGGT
back to top