FC869051

Overview
NameFC869051
Unique NameFC869051
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length678
Libraries
Library NameType
AbioticL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9452 contig Ccv1_Contig9452:1..678. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC31008A03EF AbioticL1 Citrus clementina cDNA clone C31008A03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC869051 ID=FC869051|Name=FC869051|organism=Citrus clementina|type=EST|length=678bp
GGAGAAAGAAGATGAAGGGAAACTCGTTCCGGTTGGTTAAGAAGCCTTCG
CAATTGGTGATTGGTGGTAGATATAGTTACTAGCGCATAACAATCCTGAC
TCTGGATATGGTCAAGCTAGAGTTGAATATGTAGATGTGGCTGAGTATGG
AATTGTTGATCCATTGAAAAGCACATGCAGATGCAGTGAATTAGAAAGTG
CCATGTGTTCTTTTGTTCAGGGAGTTGTGTTGTCAACTCGAAATTATCAA
TTGCTGAACATGAAAGCTGGTTCTGGCTATGGAAGGGAGCATCCAGCGAA
TTGGAGCTTGTCATAATCATACATCGAAGCAGGGAGCGCTGCTGCTTATG
GCTCATCTGTATTGTATAGCTCAGGTGAATTTGGCAACTTTAAAGAGCCT
ATAATTGGGGTTGAAGGTGATTTCTCCTGCACACTAGAGGTTCAGTGAGA
GAAAGCATATGGTGACGGCATGCACAAAGTTTGAAGTCAGTCCTGATACT
TATCCGGTGGTTTCTAGATTTCTGAATGAAGAGGAAACCAAAGCCTGGGG
TTTGGAACCATATGATACAGAGGTTGCTGATAACTTGTGCATAAAGGCAT
TGTACGCGTGGCTCATATCAAATTTTCTCTTCCATACCGGCCAACACTTT
TTCTGTTGNTAGTTTCTCTGAATGCATG
back to top