FC869208

Overview
NameFC869208
Unique NameFC869208
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length725
Libraries
Library NameType
AbioticL1cdna_library
Properties
Property NameValue
Genbank descriptionC31009F10EF AbioticL1 Citrus clementina cDNA clone C31009F10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC869208 ID=FC869208; Name=FC869208; organism=Citrus clementina; type=EST; length=725bp
GAGTCGAGGGTGCTCAGAGCAACAAAACTAAATTCTGAAGCAATTGTTCT
GACTCTTGAGTGCTTATATTTATTTCATTAATCTCGGAAGATATGGCGTC
TCATAAGGTGCCTGGTAATCGCAAATTGATAGGTGCCAAATCAGAATACT
ATTTTATGCTTTATGCAGGTACTGAAGAAGTGAAGAGCTACGACCGGATT
GATTTTGGTATGTTTGGTCGGAGTTGGGCTCCCATTGTTTCTTGGGCCGT
GATAGTGGTTCCCCACGAGCCGGAGAGTAATTGGAGAAAAAATTTACCTC
CTCCAAGTGTCAATAATATGGACCCCGCTAGCTCGCTTTGTGTCATTGCA
TCTGGTTCTTCTAATGGTTATAAGCCTATAGGTGATGATAAACATGATCG
TCCTTTTCATGGCGTTAGAACTACAGTTCGATTGAACAAATTGAAATATG
ATCGTGAAGTGTTGCGCGGAGGTTCTCTTGTTTTGGAGATTAATCTTCTA
GAGGTTTTTTCCGGAGGAGATGTTGTGGATTCTGATCATACTTTTGATGG
TCAAGTGTTCTGGAACTTGTACTCGAATTGAATATTGTACGGTGAGATAA
GTTGATGTGTGTATTAATGGTATTATCTAATATAAACATAGGATTGGACA
TATAGTTGTGTCAATGTATTGTGTAATTTAACTACCTCTAGATAATATTA
TCGTTTGTGTAATGATTGTAATTGA
back to top