FC869290

Overview
NameFC869290
Unique NameFC869290
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length732
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31010F03EF AbioticL1 Citrus clementina cDNA clone C31010F03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC869290 ID=FC869290|Name=FC869290|organism=Citrus clementina|type=EST|length=732bp
CAGTTTTACGTCTAGGTGGATCAGGTGCAAGATATAGTGCTGCTAAAGCT
TTGGAAAGCCTATTTTCTGCTGATCATATTAGGAATGCAGAATCTGCAAG
GCAAGCTGTTCAACCCTTGGTGGAGATTCTTAACACTGGGTTGGAGAGAG
AGCAGCATGCTGCTATTGCTGCATTGGTTAGGTTACTGAGTGAAAACCCA
TCAAGGGCCCTTGCTGTTGCAGATGTTGAAATGAATGCGGTAGATGTCCT
TTGCAGGATCCTTTCATCAAATTGTTCAATGGAGTTAAAGGGAGATGCTG
CTGAGTTGTGTGGTGTTCTTTTTGGAAATACAAGAATTAGGTCTACAGTG
GCTGCAGCACGATGTGTGGAGCCTCTTGTCTCTCTTCTTGTAACTGAGTT
CAGTCCTGCTCAGCATTCAGTTGTTCGTGCACTAGACAAACTTGTTGATG
ATGAGCAACTCGCAGAACTAGTTGCTGCGCATGGCGCAGTCATTCCTCTT
GTTGGACTTCTCTATGGTAAAAATTACATGCTTCATGAGGCCGTTTCTAG
AGCTCTTGTGAAGTTAGGAAAGGATAGGCCTTCTTGTAAATTGGAAATGG
TGAAAGCTGGCGTCATTGAGAGTGTACTTGATATCCTTCATGAAGCACCA
GATTTTCTGTGTTCTGCATTTGCTGAATTGCTTCGAATACTGACCAAAAT
ATGCAGCATTGCCAAGGNTCCATCTGCTGCGA
back to top