FC869305

Overview
NameFC869305
Unique NameFC869305
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length743
Libraries
Library NameType
AbioticL1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31010G07EF AbioticL1 Citrus clementina cDNA clone C31010G07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC869305 ID=FC869305; Name=FC869305; organism=Citrus clementina; type=EST; length=743bp
CGACAGCACTCATTCTCTCTCTCCGAGAAAGTTTTCTCTGTCTGTCACAT
TGAAATTCAAGGCTCCAGCTTCTCCACCCCCCACCCAACAAACAACAATG
GCGGACCATCATCGTGACCATGATCATGATCTCTCTTCACCTCTCCTCCA
ATCTCCTCGCTCCGATCATTCCCCCGTAATCATCTCCATCGAAGCTGACG
GCAACGACACCGTTTCCGACCCAGCAACTCAAGATCAACTGAACAATCAC
GATACCCGCTACCATAATAATCCTGGCAACCCCTATTGGTTTATTGGCTC
TGACGGGTTGTCTGTACCGGGGCCAAACACGGCTAATCCTTTTCTAAACG
ACACCCCGCATGTCGTTGGGGTTTATGAGTTTGTCAAGATTGTGGTGTGC
TTTCCAATTGTTTTGATTAGGCTCGTGTTGGTTGGGTTTTGTTTGTTGGT
GGGGTACTTAGCAACCAAGCTGGCTTTGGAGGGATGGAAGGATAAGCAGA
ATCCGATGCCAGTATGGCGGAGTCGCCTTATGTGGGTCACTAGGGTTTGT
TCCCGCTGTATTTTGTTCTCTTTTGGCTATCATTGGATAAGACGGAAAGG
AAAACCTGCTCCAAGACAGATTGCTCCTATAGTTGTATCTAATCACATAT
CATATATCGAACCTATTTTCTTTTTCTACGAATTATTCCCCACGATTGGT
GCATCAGAGTCCCATGATTCCATTTCGTTTGTCGGAACTATCA
back to top