FC869312

Overview
NameFC869312
Unique NameFC869312
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length654
Libraries
Library NameType
AbioticL1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9502 contig Ccv1_Contig9502:1..654. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC31010H04EF AbioticL1 Citrus clementina cDNA clone C31010H04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC869312 ID=FC869312|Name=FC869312|organism=Citrus clementina|type=EST|length=654bp
CCGGAGAGATTTCTCAAAAACACATTCCGTCCCATCAATCCCAACTCTTC
ACCCAACTACTCACGGCCTCAGTTCCTTCTCTTCGTCATCTAATATCTTC
AGGTTTGAGCTCAAGAATTCTAAATCCTCACCCTTTAACACAACCTGGCG
AAGCTCGGCCTTAATAGGTTTGGCCTTGGACAATTTAGATTCCGTAAAGC
TTCTGGAGAGAAGCTGAAGCAATTTCAACTCTGGCCGACACTCTGGTGAT
ACCCTCGCTTGCCGGAGGAGGATTTGGTTCTCTGTTTTCCAGACCTCAGT
CGTCATTTCATTATGGCTCACGCCCTTTGGTTTGGCGCCTTCCCATTGAT
TATGGCTAATGTTGCCTCAAATTATTTTCAAATGTGATCCTGCTGTTTAA
TGAATACATTGCTGTTAGAACCAAAAGCAGAAACCATCGGAGATGTGACC
ACCAGTAGCATAAATTTGTAAACTGAAGAGGTAGAAGAAGTAGAAATTTG
CTTTATTTTGGGGCTCTTTTTTCGAAGTTTGAGTTTGCTGATCTTAAGAT
ATGGCAAAATTCAGTTGCTTCTTTTTAGGTGGAGGGAGGAAGAAGAAAGA
TAAGGGAGTCGAGGGATCTTCAACATCTGTTGAATACCAAAAAAGATTAG
AGCC
back to top