FC872952

Overview
NameFC872952
Unique NameFC872952
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length655
Libraries
Library NameType
AbsDevcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionKN0AAI3DG03FM1 AbsDev Citrus clementina cDNA clone KN0AAI3DG03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC872952 ID=FC872952; Name=FC872952; organism=Citrus clementina; type=EST; length=655bp
CAAATATCTGAGTGCCACCCATATCCATATCCAAAACTAATAACATAATC
TATGTGATTGTCAAGAGATGGGCAGAGAGAGCTACCACACATAGAAATTC
TGCAAAAATGGCAGCCAGAGTGGCCCTGTATTCTTCTCTTAGTGGCAAAG
CATCAACCTGGCCAAGCTCATGGTCTCATAATCCTTTTACTCAGCAATAC
TCCCTTAGTTCTCCACCCAAGCCAAAAGCACATGGCCAGTTCAAAGTCTA
TGCGAACTTAGGGGGAAGAGATGGAGAAGTCAAGCCTAAAGGAAAAAGGA
AGTTTGTTACGAGGGAGGAAGAACCAGACGAGTTTTGGCAAACAGCAGGA
GAAAAGGAAGGGGAGAATCCCATGAAGACACCTATCCCTTACATAATCAT
ATTTGGTATGTCAACTCCTTTTGTAATCTTGGCCTTTGCTTTTGCCAACG
GCTGGATTAAGATGCCTGTTCGATGAATAAGTAGTACAGCAAACTCAGAG
AGATGATATAACATTTATCTTTTGATTTTAGTTATGTGAAAGTATCATCT
TTTATTCAATCATTTGGGTTGTAAGCATATGTTTGTAGTCTGCAACACTT
GTTTTCTTGTTTTCTTGAGTATAAACCATATGTTCAAAAAAAAAAAAAAA
AAAAA
back to top