FC872954

Overview
NameFC872954
Unique NameFC872954
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length786
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10116 contig Ccv1_Contig10116:1..786. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of FC872954 vs. ExPASy Swiss-Prot
Match: FAR1_ARATH (Protein FAR-RED IMPAIRED RESPONSE 1 OS=Arabidopsis thaliana GN=FAR1 PE=1 SV=1)

HSP 1 Score: 211.846 bits (538), Expect = 3.345e-54
Identity = 116/240 (48.33%), Postives = 158/240 (65.83%), Query Frame = 2
Query:   83 GDEINLNSIKTIEPLEGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLG-NSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQ-----HLALEEGDAQVMLDHFMHMQDENPNFFYAIDLNEEQR 784
            G ++  +    +EP  G++F++ E A+ FY+EYAKS+GF T IK SRRS+ +  FIDAKF C+RYG   ES +  S+               +R  +     KTDCKA MHVKRR  DG+WII  F+K+HNHE+ P  AY+FR  RN+ L   +N D LHA+ ERTK+M+V MSR+SGG+K +    GS++   VS+Q     +LALEEGD+QV+L++F  ++ ENP FFYAIDLNE+QR
Sbjct:   38 GGDVGFSGDLDLEPRNGIDFDTHEAAYIFYQEYAKSMGFTTSIKNSRRSKKTKDFIDAKFACSRYGVTPESESSGSS--------------SRRSTV----KKTDCKASMHVKRR-PDGKWIIHEFVKDHNHELLPALAYHFRIQRNVKLAEKNNIDILHAVSERTKKMYVEMSRQSGGYKNI----GSLLQTDVSSQVDKGRYLALEEGDSQVLLEYFKRIKKENPKFFYAIDLNEDQR 254          
BLAST of FC872954 vs. ExPASy Swiss-Prot
Match: FRS1_ARATH (Protein FAR1-RELATED SEQUENCE 1 OS=Arabidopsis thaliana GN=FRS1 PE=1 SV=1)

HSP 1 Score: 203.371 bits (516), Expect = 1.190e-51
Identity = 118/219 (53.88%), Postives = 142/219 (64.84%), Query Frame = 2
Query:  128 EGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRES-STVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFYAIDLNEEQ 781
            EG EFESKEEAF FYKEYA SVGF TIIKASRRSR++GKFIDAKFVCTRYG+K+E   T   T+  N      IP  +KRGRINRS SKTDCKA +HVKRRQ DGRW++RS +KEHNHEIF  QA                D+L               R+  G +KL+   G++V  + S +   LE+GD + +L+ F  MQ ENP FFY+IDL+EEQ
Sbjct:   23 EGREFESKEEAFEFYKEYANSVGFTTIIKASRRSRMTGKFIDAKFVCTRYGSKKEDIDTGLGTDGFN------IPQARKRGRINRSSSKTDCKAFLHVKRRQ-DGRWVVRSLVKEHNHEIFTGQA----------------DSL---------------RELSGRRKLEKLNGAIVKEVKSRK---LEDGDVERLLNFFTDMQVENPFFFYSIDLSEEQ 200          
BLAST of FC872954 vs. ExPASy Swiss-Prot
Match: FRS4_ARATH (Protein FAR1-RELATED SEQUENCE 4 OS=Arabidopsis thaliana GN=FRS4 PE=2 SV=1)

HSP 1 Score: 174.481 bits (441), Expect = 5.919e-43
Identity = 95/215 (44.19%), Postives = 129/215 (60.00%), Query Frame = 2
Query:  134 MEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFYAIDLNEE 778
            MEFE+ E+A+ FYK+YAKSVGF T   +SRRSR S +FIDAKF C RYG+K++S      + IN                 R+  K  CKA MHVKRR  DG+W + SF+KEHNH++ P+QA+YFR HRN +L  SN   L     R K   +T  +    +  LD   G + N     + L L+ GDA+++L+  M MQ+ENP FF+A+D +E+
Sbjct:    1 MEFETHEDAYLFYKDYAKSVGFGTAKLSSRRSRASKEFIDAKFSCIRYGSKQQSD-----DAIN----------------PRASPKIGCKASMHVKRR-PDGKWYVYSFVKEHNHDLLPEQAHYFRSHRNTELVKSNDSRL----RRKKNTPLTDCKHLSAYHDLDFIDGYMRNQHDKGRRLVLDTGDAEILLEFLMRMQEENPKFFFAVDFSED 189          
BLAST of FC872954 vs. ExPASy Swiss-Prot
Match: FHY3_ARATH (Protein FAR-RED ELONGATED HYPOCOTYL 3 OS=Arabidopsis thaliana GN=FHY3 PE=1 SV=1)

HSP 1 Score: 166.007 bits (419), Expect = 2.105e-40
Identity = 90/234 (38.46%), Postives = 134/234 (57.26%), Query Frame = 2
Query:   83 GDEINLNSIKTIEPLEGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFYAIDLNEEQR 784
            G+ +       +EPL GMEFES  EA+SFY+EY++++GF T I+ SRRS+ + +FIDAKF C+RYG KRE     +              +   GR  R+ +KTDCKA MHVKRR  DG+W+I SF++EHNHE+ P Q                     A+ E+T++++  M+++   +K +   K    +     + L++E GD +++LD    MQ  N NFFYA+DL ++QR
Sbjct:   57 GELVEYTEGMNLEPLNGMEFESHGEAYSFYQEYSRAMGFNTAIQNSRRSKTTREFIDAKFACSRYGTKREYDKSFNRPRARQSKQDP---ENMAGR--RTCAKTDCKASMHVKRR-PDGKWVIHSFVREHNHELLPAQ---------------------AVSEQTRKIYAAMAKQFAEYKTVISLKSDSKSSFEKGRTLSVETGDFKILLDFLSRMQSLNSNFFYAVDLGDDQR 263          
BLAST of FC872954 vs. ExPASy Swiss-Prot
Match: FRS2_ARATH (Protein FAR1-RELATED SEQUENCE 2 OS=Arabidopsis thaliana GN=FRS2 PE=2 SV=1)

HSP 1 Score: 148.673 bits (374), Expect = 3.478e-35
Identity = 92/231 (39.83%), Postives = 121/231 (52.38%), Query Frame = 2
Query:   95 NLNSIKTIEPLE-GMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFYAIDLNEEQR 784
            N+    T+  L  GM+FESKE A+ FY+EYA+SVGF   IKASRRS+ SGKFID K  C+R+G KRE +T      IN                 RS  KT CKA +H+KR+ ED +W+I +F+KEHNHEI PD  Y          G + P    AI++                                   LALEE D +++L+HFM MQD+ P FFYA+D + ++R
Sbjct:   28 NVAQCATVSELRNGMDFESKEAAYYFYREYARSVGFGITIKASRRSKRSGKFIDVKIACSRFGTKREKAT-----AIN----------------PRSCPKTGCKAGLHMKRK-EDEKWVIYNFVKEHNHEICPDDFYV------SVRGKNKPAGALAIKK--------------------------------GLQLALEEEDLKLLLEHFMEMQDKQPGFFYAVDFDSDKR 198          
BLAST of FC872954 vs. ExPASy Swiss-Prot
Match: FRS5_ARATH (Protein FAR1-RELATED SEQUENCE 5 OS=Arabidopsis thaliana GN=FRS5 PE=2 SV=1)

HSP 1 Score: 129.413 bits (324), Expect = 2.184e-29
Identity = 74/226 (32.74%), Postives = 124/226 (54.87%), Query Frame = 2
Query:  116 IEPLEGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYG--NKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIF-PDQAYYFRGHRNLD-LGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFYAIDLNEEQ 781
            +EP +G+EFES+E A +FY  YA+ +GF+T + +SRRSR  G  I  +FVC + G  N  E  T                 K +  +  R+ ++  CKA + VK  Q+ G+W++  F+K+HNHE+  PDQ +  R HR +     +  D L A     +R+   + ++ GG  K+   +    N++ + +  ++ EG+ Q++LD+   M  +NPNFFY++  +E+Q
Sbjct:   71 LEPYDGLEFESEEAAKAFYNSYARRIGFSTRVSSSRRSRRDGAIIQRQFVCAKEGFRNMNEKRT-----------------KDREIKRPRTITRVGCKASLSVK-MQDSGKWLVSGFVKDHNHELVPPDQVHCLRSHRQISGPAKTLIDTLQAAGMGPRRIMSALIKEYGGISKVGFTEVDCRNYMRNNRQKSI-EGEIQLLLDYLRQMNADNPNFFYSVQGSEDQ 277          
BLAST of FC872954 vs. ExPASy Swiss-Prot
Match: FRS7_ARATH (Protein FAR1-RELATED SEQUENCE 7 OS=Arabidopsis thaliana GN=FRS7 PE=2 SV=1)

HSP 1 Score: 78.5666 bits (192), Expect = 4.420e-14
Identity = 60/222 (27.03%), Postives = 91/222 (40.99%), Query Frame = 2
Query:  110 KTIEPLEGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLD-HQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFYAIDLN 772
            K  EP  G+EF S  EA  FY+ YA+ VGF   I    RS++ G     +FVC++ G +                                 S+  C A M +K RQ+ G WI+    K+HNH++ P       G +N  +     D                   +GG   +D  +   + NH+ S +   + +    V+LD+F   Q E+  FFYAI+L+
Sbjct:  186 KATEPYAGLEFNSANEACQFYQAYAEVVGFRVRIGQLFRSKVDGSITSRRFVCSKEGFQHP-------------------------------SRMGCGAYMRIK-RQDSGGWIVDRLNKDHNHDLEP-------GKKNAGMKKITDDV------------------TGGLDSVDLIELNDLSNHISSTRENTIGKEWYPVLLDYFQSKQAEDMGFFYAIELD 350          
BLAST of FC872954 vs. ExPASy Swiss-Prot
Match: FRS8_ARATH (Protein FAR1-RELATED SEQUENCE 8 OS=Arabidopsis thaliana GN=FRS8 PE=2 SV=1)

HSP 1 Score: 76.2554 bits (186), Expect = 2.194e-13
Identity = 59/228 (25.88%), Postives = 99/228 (43.42%), Query Frame = 2
Query:  122 PLEGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNS-----NPDALHAIRERTKRMFVTMSRKS----GGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFYAIDLNEE 778
            P  GMEFES ++A+SFY  YA+ +GFA  +K+S   R S +   A   C   G K                        K     R  ++T C+A + ++    D RW +     +HNH   P +A+  + H+      S     NP+    ++ RT +++ T++  +    G            ++H  S++ L L  G  + + D F  +Q  +PNF Y +DL ++
Sbjct:   66 PTPGMEFESYDDAYSFYNSYARELGFAIRVKSSWTKRNSKEKRGAVLCCNCQGFK----------------------LLKDAHSRRKETRTGCQAMIRLRLIHFD-RWKVDQVKLDHNHSFDPQRAHNSKSHKKSSSSASPATKTNPEPPPHVQVRTIKLYRTLALDTPPALGTSLSSGETSDLSLDHFQSSRRLEL-RGGFRALQDFFFQIQLSSPNFLYLMDLADD 269          
BLAST of FC872954 vs. ExPASy Swiss-Prot
Match: FRS3_ARATH (Protein FAR1-RELATED SEQUENCE 3 OS=Arabidopsis thaliana GN=FRS3 PE=2 SV=2)

HSP 1 Score: 73.1738 bits (178), Expect = 1.857e-12
Identity = 57/228 (25.00%), Postives = 98/228 (42.98%), Query Frame = 2
Query:  101 NSIKTIEPLEGMEFESKEEAFSFYKEYAKSVGFATIIKASRRSRISGKFIDAKFVCTRYGNKRESSTVESTEVINMDSMTGIPIKKKRGRINRSWSKTDCKACMHVKRRQEDGRWIIRSFIKEHNHEIFPDQAYYFRGHRNLDLGNSNPDALHAIRERTKRMFVTMSRKSGGHKKLDHQKGSVVNHLVSAQHLALEEGDAQVMLDHFMHMQDENPNFFYAIDLNEEQR 784
            + I   EP  GMEF S++EA SFY EY++ +GF + +      R  G     +FVC+       SS+                 K+ + R++ S     C A + ++ +  + +W++  F+KEH H +      +    R     +        +   +  M+V+M   S G +          N  ++         DA  +L++F  MQ ENP FFYA+ L+E+ +
Sbjct:   42 DEIGIAEPCVGMEFNSEKEAKSFYDEYSRQLGFTSKLLP----RTDGSVSVREFVCS-------SSS-----------------KRSKRRLSES-----CDAMVRIELQGHE-KWVVTKFVKEHTHGLASSNMLHCLRPRRHFANSEKSSYQEGVNVPSGMMYVSMDANSRGAR----------NASMATNTKRTIGRDAHNLLEYFKRMQAENPGFFYAVQLDEDNQ 225          
The following BLAST results are available for this feature:
BLAST of FC872954 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 9
Match NameE-valueIdentityDescription
FAR1_ARATH3.345e-5448.33Protein FAR-RED IMPAIRED RESPONSE 1 OS=Arabidopsis... [more]
FRS1_ARATH1.190e-5153.88Protein FAR1-RELATED SEQUENCE 1 OS=Arabidopsis tha... [more]
FRS4_ARATH5.919e-4344.19Protein FAR1-RELATED SEQUENCE 4 OS=Arabidopsis tha... [more]
FHY3_ARATH2.105e-4038.46Protein FAR-RED ELONGATED HYPOCOTYL 3 OS=Arabidops... [more]
FRS2_ARATH3.478e-3539.83Protein FAR1-RELATED SEQUENCE 2 OS=Arabidopsis tha... [more]
FRS5_ARATH2.184e-2932.74Protein FAR1-RELATED SEQUENCE 5 OS=Arabidopsis tha... [more]
FRS7_ARATH4.420e-1427.03Protein FAR1-RELATED SEQUENCE 7 OS=Arabidopsis tha... [more]
FRS8_ARATH2.194e-1325.88Protein FAR1-RELATED SEQUENCE 8 OS=Arabidopsis tha... [more]
FRS3_ARATH1.857e-1225.00Protein FAR1-RELATED SEQUENCE 3 OS=Arabidopsis tha... [more]
back to top
Libraries
Library NameType
AbsDevcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAI3DG06FM1 AbsDev Citrus clementina cDNA clone KN0AAI3DG06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC872954 ID=FC872954|Name=FC872954|organism=Citrus clementina|type=EST|length=786bp
AAATGTCTCTGATAATAATAAGGAAAATACTAGACCTAAGATTAGTAGAA
CAGTGGTAGATGGTAGACAGAAAGCTTATGCTGGAGATGAAATTAACCTG
AATTCCATTAAAACTATAGAGCCTCTAGAGGGAATGGAATTTGAATCGAA
GGAAGAAGCATTTTCTTTTTATAAAGAGTATGCTAAGTCAGTGGGTTTTG
CCACCATTATAAAAGCTAGCCGTCGATCAAGAATATCTGGAAAATTTATT
GATGCCAAATTTGTATGTACTAGGTACGGAAATAAGCGAGAATCAAGTAC
GGTAGAATCTACAGAAGTCATCAATATGGATAGTATGACAGGCATTCCCA
TTAAGAAGAAACGGGGTAGAATTAATCGGTCTTGGTCAAAAACTGATTGC
AAGGCTTGCATGCATGTGAAGAGAAGGCAAGAAGATGGAAGATGGATTAT
TCGCAGTTTCATAAAGGAGCATAACCATGAAATATTCCCAGACCAGGCAT
ATTACTTTCGGGGTCATAGGAATTTAGATCTAGGTAATAGTAATCCTGAT
GCCTTGCATGCAATCCGGGAGAGAACAAAAAGAATGTTCGTCACAATGTC
TAGAAAATCTGGCGGGCATAAGAAACTAGATCATCAGAAAGGAAGTGTTG
TAAATCATTTAGTAAGTGCTCAACATTTAGCTTTAGAGGAAGGAGATGCT
CAAGTTATGCTTGATCATTTTATGCATATGCAAGATGAGAATCCTAACTT
CTTTTATGCTATAGATCTGAATGAAGAGCAGCGTTT
back to top