FC872956

Overview
NameFC872956
Unique NameFC872956
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length614
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14454 contig Ccv1_Contig14454:186..799. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
AbsDevcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAI3DG08FM1 AbsDev Citrus clementina cDNA clone KN0AAI3DG08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC872956 ID=FC872956|Name=FC872956|organism=Citrus clementina|type=EST|length=614bp
TGGGTGTGGATATTATCTGATGGCGGGAACGTGATCAGATCAGACGTTGA
CGAAACGCCGATGGATGCGATGAAAGTTACACGCAGTATCATGATAGTGA
AACCACCCGGCTATCAAAGCGGCTCGCCTCCGGTATCTCCCGCCGGGTCG
ACCCCTCCGGTATCTCCCTTCTCTGCTGGTGGCAGAGACTCTTTTCGGTT
TCGCAGAAGATCTGCATCAGACGCATACGAGAAGAGGAATGAGGTTGGAC
TCAGGAGCCCTACTACTCCTTACGACGTGTGATATATGAAAAATGAAGAG
ATGTGCAGCCAGAGTGTTGGAGCTTGTATGTTGATCTATAAATATGGGCA
TGGAGTTGGGGTGTGTTTTGTCTAGATGTGACAACCGAGTAGTGAGATCT
TAAGCTTCATTGTGGCTTGTGAGGCAGGGTTGTAAGTTGTATTATATGTA
GAGAGCCTGTGCTGTCGGCACTGTGTTATGTAGCTTTCTTCTTGTTGTGC
ATAATTTAAGAGCTTCTGCTTCTGTACGCGTTCTCCGTTGGCTGTTTTGT
GCTCTTAAATCCTCGTTGTGTTTCCAGTCTCTTGTTTTTGGAATAAGATG
GTGCCGTTTGTAGT
back to top