FC872957

Overview
NameFC872957
Unique NameFC872957
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length186
Libraries
Library NameType
AbsDevcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAI3DG09FM1 AbsDev Citrus clementina cDNA clone KN0AAI3DG09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC872957 ID=FC872957; Name=FC872957; organism=Citrus clementina; type=EST; length=186bp
TCAAGTCCTTGTTAGTGGTGGTGGGGGTGGTGGCTCTAGCAGCTCATCAC
AAAGCAGCAGGTTTGTTTATCACGAGTCAAAACCAACCACGCAAGACCAT
GTAAGCTTGGATCTACACCTATAGTAATATTACTTTAAAATTAATATTAT
TATTATTATTATTATTATTATTATTATTATATCAAA
back to top