FC872960

Overview
NameFC872960
Unique NameFC872960
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length819
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig1286 contig Ccv1_Contig1286:1..819. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
AbsDevcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAI3DH03FM1 AbsDev Citrus clementina cDNA clone KN0AAI3DH03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC872960 ID=FC872960|Name=FC872960|organism=Citrus clementina|type=EST|length=819bp
AAGCAAAGGATGAATATGCGGGCTCCTCTTGGGATGAACTTAAGCACATT
AGACAGGCTGTTGGATTCCTGGTTATACATCAGAAGTATAGAATTTCTTA
CGATGAAATAACCAATGATCTCTGCCCCATCTTGAGTGTCCAGCAGCTGT
ATAGAATATGCACACTATACTGGGATGACAACTACAATACTCGAAGTGTG
TCGCCAAATGTCATTTCGAGCATGAGGATACTTATGACCGAGGACTCTAA
TGATGCCACCAGCAATTCCTTTTTGTTGGATGACAATTCCAGCATTCCCT
TCTCTGTTGATGACCTTTCTAATTCACTGCAAGAGAAGGATTTCCTGGAT
GTCAAAGCCGCGGAGGAACTTCTTGAGAATCCAGCCTTTGAATTTTTATA
TGAGGCATAGGAAGCTCGAACATGCTCTACTTAGTATTTTTTTTGGAGGT
AGGCAGTGAAGTCAAAACTCTTTGATCAACATCAAAGGAAGTTGTAAATC
CAGTCTTTTTTCTATTATATAATTTTTGTTTCATTCCATTGCTTTTACTA
CATCCATGCCCCGTTGTAAAATTTCTATTTGTTTAATTTTTTTGACGTAC
AGCTTTGTAAAATCCATCATATTGAGGGGCAGGTATTTACTTGTTTGGTT
GAGTGAGCGTTCCTTTTTTTGTTTAATTTTTTTTTTTTGGGGGGGTTTTC
CATTGTTTTGTTCTGGCCACAATCGGCAGCAATTTTTAGTGTTAAGAAAA
AAAAAGTTCATAGTAGTCATTGTAGTTTAGTGATCGAGGCGTTGCCACCC
CATTTTTATTGTATAAAAA
back to top