FC872962

Overview
NameFC872962
Unique NameFC872962
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length469
Libraries
Library NameType
AbsDevcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionKN0AAI3DH05FM1 AbsDev Citrus clementina cDNA clone KN0AAI3DH05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC872962 ID=FC872962; Name=FC872962; organism=Citrus clementina; type=EST; length=469bp
GTGTCGTGGCCTTTTCAGTTCCAGCCATATGGAGACCTATATGTGGTCAA
ATTGGATGGCAGTGGATTAAGGAGGCTGACATGGAACGGATATGAAAATG
GAACGCCAGCGTGGCATCCAGGCAATCAGCTAGATTTGGGGAAATTGCGT
CTCGAGGATGACATTGGAGATAAACTGAGGGGCCAATTTGATGAGCCACT
TTGGATCTCTTGTGATTTTTAAACCTATTTTTCACCTCCATTATGTTCGC
TGCGATATCGAGAGTACAACTCATTTCATTGGAGTTGTGTATTGTCTATT
ATCGCTAATTTATGTACGCTTTAAATTGAATAATCTTTAGATTAAGAAAT
ATAATGTTTGTACGCGTACAAACATAGTTGAATAAATGGCTGCTTGTTGT
CTCTATTATTTTGTTCCACATTAATATTAAAATATTTGATTTCAATTAAA
AAAAAAAAAAAAAAAAAAA
back to top