FC872970

Overview
NameFC872970
Unique NameFC872970
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length318
Libraries
Library NameType
AbsDevcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAI2BA02FM1 AbsDev Citrus clementina cDNA clone KN0AAI2BA02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC872970 ID=FC872970; Name=FC872970; organism=Citrus clementina; type=EST; length=318bp
ATTTGAAGATTATGGGAACTCCTTGCGCAGGTTATACCGATTGGTCGGAG
GGTGGGGCCCCCCCATGGTTTTCACTTATTGCTGATGATGAAATTAATGG
AAATATTGATCTTCTTGTAGTCCCACAATATGGAAGAAACCCTGATCACA
CTGGTTAAGAATATGCAGTATTAGTCTCTTATGTTATGTTTAATAAAATA
AAAGTATGGGTACTGTTATTACCCGTCAATTGTACGATGGTCTCAGTTTG
GTTCAGTTTAACTTGTAAGATCTCTTGATATATACCACACATTCTCTTTG
TCTAGTATAAAAAAAAAA
back to top