FC875260

Overview
NameFC875260
Unique NameFC875260
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length335
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig904 contig Ccv1_Contig904:264..598. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
CTVClemen1cdna_library
Properties
Property NameValue
Genbank descriptionC31402A03EF CTVClemen1 Citrus clementina cDNA clone C31402A03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875260 ID=FC875260|Name=FC875260|organism=Citrus clementina|type=EST|length=335bp
GGGAAAGTCAAGGCAGGCGGTGCCTACACTTTGAACACTGCTAGTGCTGT
GACTGTGAGGAGCACAATCCGTAGGTTGAGGGAGCAAACTGAAAGCTGAG
CTTGCCACCATTGGCTTACTCCCGTGTCTTAGGTCGTTTGATCTTTAGTT
TCGGATACAACCTTAAATCATTTTTGATGTTGCTTTATTTCTAGATGCAA
AACAATTGGTTGTTGGAACATGAAACTTTTGGCTGTGTTTTGACTCTTGA
GATGTTCATTCGCTATTTTTCCTATGAAATTATGTTATCTAGTGGGTTTT
CCTATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top