FC875265

Overview
NameFC875265
Unique NameFC875265
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length634
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10191 contig Ccv1_Contig10191:1..635. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
CTVClemen1cdna_library
Properties
Property NameValue
Genbank descriptionC31402A08EF CTVClemen1 Citrus clementina cDNA clone C31402A08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875265 ID=FC875265|Name=FC875265|organism=Citrus clementina|type=EST|length=634bp
GAATCTGATTTCGATCTATTTGTCTGCAATCTTCTCATCGTTATATCACC
AAAGGAAAACAAAAAATGTCTGGCTGTGGTGGAAACTGTGGCTGTGGTTC
TAGCTGCAAGTGCGGCGGCGGCTGCGGCGGTAGCGCCATGTACCCTGACT
TGAGATCCTTTGAGAGCACCACCGTCGCCACCGAGACCCTCGTCCTCGGT
GTTGCTCCTGTCAAGATGCACTCTGAGGGGTCCGAGATGGGATTCGGAGC
CGAGGGCGGCTGCAAGTGTGGACCAAACTGCAAGTGCAACCCTTGTAACT
GTTAATGAAGATTACGAGACGTGAACATGCCCCATAATAAAGCAGCGCTG
TGAGGTCGTTTAAATTGTAGTATCAATAAAAAGAACTATTTGTCTTTTGT
GGTTGGCTTTGTTGGATGTCTTTTTATGAGCTTTTGTTTGTAAAATAAAA
ACCAGCCATGGCTGCTTCTCCGAATCCTTAACTGGGTTTGTTGCAGATCC
ATGGCTAGTTAATTAATCATTAAGTGTATCTGTTACTGCTGCTTTTCTAA
TGGGAAGCTTCCTCTCAGACTTTTATCTATATTGTAAAATGTGTTTGGTT
CATGTACTGTATAATAAATTTACAACGTTTGGAT
back to top