FC875270

Overview
NameFC875270
Unique NameFC875270
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length569
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10319 contig Ccv1_Contig10319:49..617. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
CTVClemen1cdna_library
Properties
Property NameValue
Genbank descriptionC31402B02EF CTVClemen1 Citrus clementina cDNA clone C31402B02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875270 ID=FC875270|Name=FC875270|organism=Citrus clementina|type=EST|length=569bp
ACACTGAGCGATAACGCAAGGAAACGAAACAATGGCGTTGAACAATGGGA
TCAGATCAGTCTCAAAGCTCCTCGCTTCCTCCCAATCGCTTGTGCCCAGT
TCAGTGAACAGGGCTTTCCACTCAACTGGAGTGAAGAGGATGGGGGGACA
TGGGCATGATGAACCATACTACCTTCACGCCAAGCACATGTACAACTTGG
ACAGGATGAAACATCAGGGGCTGAAGATGTCTCTTGCTGTGTTCTCTGCC
TTCAGCATTGGTGTTGGTGTTCCTATTTATGCTGTCATTTTCCAGCAGAG
AAAGACTGCTTCTGGCTAGGACTACTTATTTTCTTGGTTGCAATAACAAA
CAACTTTGAAATGTGTCTGTAGCAAACTGTTGCTATATTGGTGGTTTTAA
TGGATGGCAATTTCATAGTAAAAAGGCTTTCTGTCTTGTCTTTGCTGCAG
GATGTTATCATTCTTATATCTTTAATGGGATTTTTTGCACTTTCATTTTG
TAATAATTTATTGGGTTGGTGCTAAGTTTGATTGAATAATGAGTTCAAAG
TTCAAGCAAAAAAAANAAA
back to top