FC875277

Overview
NameFC875277
Unique NameFC875277
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length707
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
CTVClemen1cdna_library
Properties
Property NameValue
Genbank descriptionC31402B09EF CTVClemen1 Citrus clementina cDNA clone C31402B09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875277 ID=FC875277|Name=FC875277|organism=Citrus clementina|type=EST|length=707bp
GGTACTTGGAATGTTAATGTGTACTACAAATTGTTCGTGTATGATCAGGT
ATCGAACCAGTACTTGGTAGTTCAAGATGCCAAAGCCCCAATGAGGCGTT
TCGATAGGCGGAAGACTGACTGGGGTTTCGGCAAGTTTCTTGACCTTGCA
ACTTTTAATGAACCTTCAAATGGGTACCTTGTTGACGATACATGTGCATT
TGGTGCTGAGGTCTACGTTGTTAAACCAACTGACAGCGAGGAAATTCTTT
CCTTGGTCAGTGATCCTGCTGACGGAAATTATCGTTTTAACATCCCAGCT
TTCGGTTCTGTGGGTGATACGGTTCAGCGCTCGAGTGAGTTCACTGTTGG
AGAAAGAAATTGGCAACTAGTGGTTTATCCAGCAGGATCTGGAGCTGATA
GAGGCAACTTTCTAACTGTTTCATTAAAGCTAGCTGATTATCAAACGGTT
TCACGCAAGAAACCAGTTTATGCAGAATTTAAGTTCAAAATACCCAACCA
ATACAGCAGGAACAGAGCTGGCGCTGAACAAACAGTTAAGCATTTTTTTA
ACTCGGCTGCGGAGAAAGAGTCCTCAAACCTTTTGTCGAGGAATGATCTG
TATGACACCACCAAGGGATACCTTCCAAGTAGTGAAACTCTAATCGTTGA
AGTCCAGTTTCTGGTCGTTTCATGATTATGCCAATAATTCATGTATCATC
ATCATGC
back to top