FC875281

Overview
NameFC875281
Unique NameFC875281
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length681
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC875281_ssr73 microsatellite FC875281_ssr73:73..87. BLAST: Citrus ESTs to Prunus persica proteins V1
FC875281_ssr255 microsatellite FC875281_ssr255:255..266. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig15429 contig Ccv1_Contig15429:2..654. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
CTVClemen1cdna_library
Properties
Property NameValue
Genbank descriptionC31402C01EF CTVClemen1 Citrus clementina cDNA clone C31402C01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875281 ID=FC875281|Name=FC875281|organism=Citrus clementina|type=EST|length=681bp
ACATAAACGAATTTACTCTCTGATAAACACTTTTTAATATATATTTTCAC
TTACCTGCAGTCGTAGCGCTATCTGCTGCTGCTGCTGCTCAAAATGGCTG
AAAGGATCCACCCCGAAACGACACCGCGCAGCGAACAAGAGCCCTCACAT
CCGCCGGCGCCCGCGGCCGCAGGAACCTACGTCATCCAAGTCCCGAAGGA
TCAAATCTACCGAGTTCCGCCCCCCGAGAACGCCGACCGCATCAAGGGCC
TCTCCCGCCGCCGCCGCAAATCCCGCAGCACTACTACCTGCTGCTGCTTC
CGTTTCTGCTGCTGCTCGCTGCTTCTCCTCGTCCTCCTCTTGGCCATCGC
CGCCGGCGTCTTCTACCTCGTCTTCCGTCCCGAATCCCCCAACTACTCCG
TCGACGGCGTCTCCATCGCCGGCCTCAACCTCACCTCGCCGTCCTCCGTC
GTCTCTCCCCGGTTCGACGTCTCCGTCACCGCCGACAATCCGAACGACAA
GATCGGAATCTACTACGAGAGAGGCAGCTCGGTGGAGGTCTCCTACAAGG
ACGTCGCCTTGTGCGACGGCGAATGGCCTCAGTTTTACCAGCCGAAGCAC
AATGTCACGGTTTTCAAGACCTTGCTGAAAGGATCGTCCATCGAGTTGAC
CAGCTCTATGCGCAAAGACCTGGTTGCTGCT
back to top