FC876159

Overview
NameFC876159
Unique NameFC876159
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length658
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC876159_ssr32 microsatellite FC876159_ssr32:32..49. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig12292 contig Ccv1_Contig12292:55..712. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
DevOvary1cdna_library
Properties
Property NameValue
Genbank descriptionC32001A02EF DevOvary1 Citrus clementina cDNA clone C32001A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876159 ID=FC876159|Name=FC876159|organism=Citrus clementina|type=EST|length=658bp
GCTCAAACAGAGTGCACACACAGCAGCTACTGAGAGAGAGAGAGAGAGAG
TTGAGCAGTGAGAAATATGGCCGAGAAAATGGTGAAAAGCTCTTCAATAA
CTAGATGGGTTTCTCTGTTTATGTTTGTTGTTGCTCATTTGGCTTCTTCA
ATCCTAGCCGAAGATGGTTTAGTGGCTAATGGCGATTTTGAGACATCCCC
GTCGCACGGCTTCCCGAGTGAGTCCATAGCAGATGGGCCCACAGAGATTC
CAAGCTGGAAATTAAACGGCACCGTAGAGCTGGTCTCATCTGGGCAAAAA
CAAGGTGGGATGATCCTCATTGTGCCACAGGGTTCTCACGCTGTTAGATT
AGGCAACGATGCGGAGATCAGCCAGGAAGTGAAAGTTGAAAAAGGGTCTA
CGTATTCCGTTACGTTCAGTGCGGCGCGCACGTGCGCGCAGCTGGAGTCG
CTGAACGTGTCCGTGCCACCTGCATCACAGACCATAGACCTGCAGACATT
GTATAACGTGCAAGGGTGGGACCCGTACGCGTGGGCTTTTGAGGCAGAAG
ACGACAATGTGAAGCTTCTTTTTAAGAACCCGGGCATGGAAGATGACCCC
ACTTGTGGGCCCATCATTGATGATATTGCGATCAAGAAGCTTTTCGCTCC
TGATAAGC
back to top