FC876160

Overview
NameFC876160
Unique NameFC876160
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length697
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10300 contig Ccv1_Contig10300:1..697. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
DevOvary1cdna_library
Properties
Property NameValue
Genbank descriptionC32001A04EF DevOvary1 Citrus clementina cDNA clone C32001A04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876160 ID=FC876160|Name=FC876160|organism=Citrus clementina|type=EST|length=697bp
AAGATGAACTTTCACGAGTAAACATACATGAAAACCAGAATGTAATCATA
GCGCAGCATATTAGAGTCCCTGAAACTGATCGCTGCCGGCTGACATTTGG
CAGTTTCGGAGTGGATTTTGAATCTTCCCGGAATTTGGGATCCGGGTTTC
TAGCAGCTGGTTCTGCTGAAGAATCAAATGGTGAATCTGCTGCAAGTTTG
ACTGGAGCTGCTTCCAAGACTTCTGGTAATGATGTTTCTGGCAGAAAGCC
TGTAGATATTCTCGATGATCTTGTTAGAAATTCTGGATCTAACTCACCAG
CATCGGGTGAAGCATCCGAGCATCAATTGCCTGATGATATTAAAGATGCT
TCAAGTCCTCAGGATTTGGACGGCTATGCTGATATTGGATTGGTTCGGGA
CACTGATCCATCCTATCCTCTTTCAGAGTCGCAACAGCAGCAAGATTCAT
CAGAGTTGGCAAGTTTTCCGCAGGCATATGATTCCCAGACTGGTTATGAT
ATGTCATATTTCAGACCCACAATGGATGAAAGTGTACGGGGACAAGGCCT
ACCTTCTCCTCAGGAGGCTTTAGCCTCGCACAGTGCCAATAGCATCCCTG
CATCATCAATAGCCATGTTACAGCATCAGCAGCAGCCCCAGATGGCCCAG
ATGTATCCTCAAGTCCATGTTTCCCATTTCCCCTATATGATGCCATA
back to top