FC876175

Overview
NameFC876175
Unique NameFC876175
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length657
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC876175_ssr18 microsatellite FC876175_ssr18:18..32. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig9113 contig Ccv1_Contig9113:74..730. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
DevOvary1cdna_library
Properties
Property NameValue
Genbank descriptionC32001C01EF DevOvary1 Citrus clementina cDNA clone C32001C01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876175 ID=FC876175|Name=FC876175|organism=Citrus clementina|type=EST|length=657bp
AAAAAAGAAAGAACACAATCATCATCATCATCACAACAAACAGATTAAAA
AAAAAAACAACAATAACAAATTCTATCCTCAAACAAAAGAAAAAAAAACC
ACCGCCACCCACCACCCGCCACCGTCCGATCATATTTTGCCGGCCAACAT
CATCCCCGATCATCGATTTTGTGATCTGGGTCGATGGCGGAATCGGAGAA
GAATCTCGAAATTTCAAGCAAAGCGTCATCGTCTTCTTCTTCGATGTTGT
TGAATCGGTCGTTTACTATGCACGCAACCGCAGCTGATTCTTCTCTCCCG
AAACTCAATTATGCCTCTCTCAATCGGGCCGTTTCGAGCAATAAGTTTTA
CAATTCGATGGAATCAGTCTTATCTGCTAGCAATTCATTCAAAGGTAAGG
TCAAGCAACTTCGTAATTTATTTGAGCCCAAAAAATCATCCAAAAAAATT
AATTTAAACGAACCCGAATCCCCGCAACAGCACCACCTCATCAAGTTAAC
AAAACCCGTGAAATCTTTATCTTTGTGTTATAATAATGAGTCTTCGATTA
GATTACCGGGTACTGAGGATCGAATTGTTGTTTATTTAACGAGTCTGAGA
GGGATTCGAAGGACTTTTGAGGATTGTTATGCGGTTAGGATGATATTTAG
AGGGTTT
back to top