FC876178

Overview
NameFC876178
Unique NameFC876178
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length692
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig4539 contig Ccv1_Contig4539:42..733. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
DevOvary1cdna_library
Properties
Property NameValue
Genbank descriptionC32001C04EF DevOvary1 Citrus clementina cDNA clone C32001C04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876178 ID=FC876178|Name=FC876178|organism=Citrus clementina|type=EST|length=692bp
GGCTCTCACAAATTAACAAAAATCGCTTCTGTTTAAGCTGTGTTTGGCGT
TTATCTTTTAAAAATAAGCATATTGTATGGTAGAAGCTGATCATGTTATT
TTGAGCTGAATTGAGCTGAGGAAGGAAAAACAAAACAAAATCAAAAACTG
TGTATTAGAAGAAGGAAATAAAGGAAACGACGTCGTGATGGTGATGAAAG
AAAGAGATGAAGAGCTGGCTTTGTTTCTTGAAATGAGAAGACGAGAGAAG
GAGAAGACTAACCTTCTACTTCCTCTTAACTCCGACAACCACAATGCTCC
TTCAGGAACAAACGACGGAGGATCTCCGATATCAAAGATTGTGTCGTCCG
TTCCGATACGCAAGACCGCTGCTGAAAATTTCTTGAATTCGGAGAGTGAA
AACGATAAATCTGATTATGATTGGCTTCTTACACCACCGGGTACCCCACT
TTTTCCTTCCTTGGAGATGGAATCACAAAAAGCCAAACTGAATCAGATGG
AGATGCCTAATGCTCGTCCAACTGCTCTGAAAACAAGGCTGGCAAATGTT
CAGGAAGATCCTGCTTCGAGGGGTAGTGTCCTTTCTAAGAATCCCAATTT
GCCTTCTAGGGTGAACTCTTCCAGTACTGGTGACAGCAGGCCATCATCTT
CTGGTGGACGAACATCTAGTGCTAGAGCTGCTACACCAACTG
back to top