FC876455

Overview
NameFC876455
Unique NameFC876455
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length830
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10363 contig Ccv1_Contig10363:1..830. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
EHRcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAN2CA02RM1 EHR Citrus clementina cDNA clone KN0AAN2CA02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876455 ID=FC876455|Name=FC876455|organism=Citrus clementina|type=EST|length=830bp
GCACGAGGGTCTGTTGTGGGTAACAGGACACTGGTTATCAGTATTTATGG
AACTGCAAAGAGCATTTGGATAAGGTGTATGAAATTAATATTAATGTTTC
TGCTTTTTTTTTTATTTTTTTAATAAATTTTACTTCACAAAAATAAAGAA
AGTAAGCCTACTAAAATAAATAAAGCTTGTAGGTTTCTCGCATTATTCTG
GGAACTGATGCAGATACACCTGGCCATGCCTTGGCTGAAGAGCTAGCACG
TCGACTTGGAAAAGACAGATGCTGGCGTGTACGTTGGCCAAAGAAAGATG
AGTTCAGTTACTTCAAAGATGCAAATGAGGTTTGATACTTGTTTCCACCC
TTTTGCCTGTCATATTACCTTGGAAGAAGCAAAGATGTAACTTTTGGATG
TAGTTAGCTAAATATATAAATCTGTCTCTGGGAATAGTTTTCTAAACGTA
CTTATCGTTACTGTCTCTACAATTATGCTTCTCCTTCGTGAGAAATGCTT
ATCCATTACTCTTAGATAACTCAACTCCCTTCTTGGCAAGAGATAAGTCC
TAGCATTACTTTAGTTTTTGTCACTGTACTATCAACCTCTGTGCTTATTA
CATATCTGGTTTGCTACCATAGGTTCTCAAGTGTTTGGGTCCGGGAGCTC
TGAGGGAAGTGATTGAAAACGCAGAGTTATATCAGCTACATGTTTCGGAG
GAAGCATTACAGTGTACAAAGTAACAAGAAAAACACATCCATAGAAGTAG
AGGGTTTCTTTTCTTGATCCAAGGAATTTTCTTGTAGCAAAATTTATAGC
TGATTTACGTCTTTCAATTTAGTTTTGGGC
back to top