FC876465

Overview
NameFC876465
Unique NameFC876465
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length899
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig635 contig Ccv1_Contig635:71..969. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
EHRcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAN2CB02RM1 EHR Citrus clementina cDNA clone KN0AAN2CB02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876465 ID=FC876465|Name=FC876465|organism=Citrus clementina|type=EST|length=899bp
GCACGAGGGCCATCGCTGCTTCCTTCAAGTTTGAAAGCGTCTCCAGTCCA
CGGTTGCTGCCGCTGCCGTTTCCTTCTGACTTCAAAATCCAGCTGCCACT
ACTACCGGGGTGCATGGTGGTGGTGAGAGAGGAAGCTCAGGGGATCAATT
TAGATAGCGGAAAGACGGAGGAGAAGGTTGTTGACTCTGCTGTGGTCACT
GGTCACCGAGCTCTCTAAGCCCTTCACCGTGTATTGCAGCCTACAATTTG
CAGGTAATCTAAGCCCCTCACCGAGTGACTGTGCTGACTCTAATGCTTTT
CTTTTATTCTATTTTTGTTGCCGACTTGCCATAAAATTACTTTCTGTTGC
ATGTTTTGGACCCTCGAGATGTTAGTTTGAAGCATTCCTTTTATCAATTT
CTTATTAAAATTACGAAATTGAACTATGTTCTCAAGTTATTGTAGAAATG
TGTCACTGCCAAGCTGGGTTAGAATATTTCTCTTTATTTGCAAAAAACGG
AATCTCACATAATTTTGAATTTTGCAACCCACATTTCAAATAAATAAACA
ATAGGATTCAGAATATTGGGACAACCTTGGGAACTTGTTGCTAATTGATT
TGAAGAATATTAACATTTAGAAGAATATTAGAATTTTATATTTTATTGAA
CTTTTGATTAATCAAGTTAAAATTTTATTTTTAGAATATTGGAGTTCATT
CTATTAATACATCAAAATCTAATTCACTGAGNAATATGATTTTATTTTTG
GGTTTGTACACACTTGTTACACAAATTTGAGCTCCATTATGCGCGGAGAA
TATATACAATCTACTTGCTGTTTTTTATGTATATTTTTTGTTCGCAGACA
AAGTGTGTATGATTTTGTTCTGTGCATTCATAAAAAATAAAATAGTGAA
back to top