FC876478

Overview
NameFC876478
Unique NameFC876478
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length909
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig635 contig Ccv1_Contig635:71..979. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
EHRcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAN2CC03RM1 EHR Citrus clementina cDNA clone KN0AAN2CC03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876478 ID=FC876478|Name=FC876478|organism=Citrus clementina|type=EST|length=909bp
GCACGAGGGCCATCGCTGCTTCCTTCAAGTTTGAAAGCGTCTCCAGTCCA
CGGTTGCTGCCGCTGCCGTTTCCTTCTGACTTCAAAATCCAGCTGCCACT
ACTACCGGGGTGCATGGTGGTGGTGAGAGAGGAAGCTCAGGGGATCAATT
TAGATAGCGGAAAGACGGAGGAGAAGGTTGTTGACTCTGCTGTGGTCACT
GGTCACCGAGCTCTCTAAGCCCTTCACCGTGTATTGCAGCCTACAATTTG
CAGGTAATCTAAGCCCCTCACCGAGTGACTGTGCTGACTCTAATGCTTTT
CTTTTATTCTATTTTTGTTGCCGACTTGCCATAAAATTACTTTCTGTTGC
ATGTTTTGGACCCTCGAGATGTTAGTTTGAAGCATTCCTTTTATCAATTT
CTTATTAAAATTACGAAATTGAACTATGTTCTCAAGTTATTGTAGAAATG
TGTCACTGCCAAGCTGGGTTAGAATATTTCTCTTTATTTGCAAAAAACGG
AATCTCACATAATTTTGAATTTTGCAACCCACATTTCAAATAAATAAACA
ATAGGATTCAGAATATTGGGACAACCTTGGGAACTTGTTGCTAATTGATT
TGAAGAATATTAACATTTAGAAGAATATTAGAATTTTATATTTTATTGAA
CTTTTGATTAATCAAGTTAAAATTTTATTTTTAGAATATTGGAGTTCATT
CTATTAATACATCAAAATCTAATTCACTGAGAAATATGATTTTATTTTTG
GGTTTGTACACACTTGTTACACAAATTTGAGCTCCATTATGCGCGGAGAA
TATATACAATCTACTTGCTGTTTTTTATGTATATTTTTTGTTCGCAGACA
AAGTGTGTATGATTTTGTTCTGTGCATTCAATAAAAATAAAAATAGTGAA
AAAAAAAAA
back to top