FC877793

Overview
NameFC877793
Unique NameFC877793
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length907
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC877793_ssr365 microsatellite FC877793_ssr365:365..379. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig3226 contig Ccv1_Contig3226:1..907. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
IVIA1cdna_library
Properties
Property NameValue
Genbank descriptionIC0AAA24CC05RM1 IVIA1 Citrus clementina cDNA clone IC0AAA24CC05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877793 ID=FC877793|Name=FC877793|organism=Citrus clementina|type=EST|length=907bp
CCAACAGTACTCGCTTCCCTCTCTGAAGTCTCAAAACAGCAACGCGGCAT
GTCAAACGAGGTTACTTATGCTTATAAAACTTAATTTCATTAAAAAAAAA
AAGAATCTACTGCTTCTCTGAACTAATTAATTAAACGTTCTCTGCGGTGT
GTTTTATAAATTCTCTCTCAAGACTCATCTTATTTGCATTGTTTTAGCAA
GCAATGTTGTTTATTGCTTGTGCTTCAAGCTTAACACTTTTTAACTCTCG
AAAATAAATAGCCGTTGGTGAAGCTCTTATGACAGTGGAGCCCCTGATGT
CTCCTTCATCCATTTTGTGGTGAAGGTGGTGGTGCGACCCACAAGAGAAA
GGAGGAGGAGCAGACGGCGGCGGCGGCGGTGGTGATGGAAGGGAGAAAAA
AGAAAACAGTGAAGGATGGATCAGCGTCAATCAAATGCGAAAACCCAATG
CTAACGCCTGCTCAGTTTTCCGAGTTTCAAAGACAAGTTCTCATTTTTGA
GCATATGAAAGCTGGGCTTCCTGTTCCTTGTCATGTTTTGATGCCCATGT
GGAGGGAAGTTGCTAGCTCTTTTGGGTCTGATCCCAGTAGTGTTTATAAT
CTATATCCCAGCCGCCTTGGTTGGGAAAGTTGGTCGAAAAGTTGATCATA
GGATCGTGATGGATCTAGAACCGGGGAGGTGCAGAAGAACTAATGGAAAT
AAATGGAGATGCAGGAAGAATTCAGTTCCTGATCAGAAGTATGTTGATGC
TTCTCAGATTGCAAATCTTTTAGGTACAAATTCACCCAATGATTCTCAGA
ATTTGAAAGCCATCATTACTAACCTCCACACACATCATTACTAACACCCC
CCATAGTGATAACAACATTACAACAATGATGGTGTTGACTGCATAAATGC
TACTGCT
back to top