FC877795

Overview
NameFC877795
Unique NameFC877795
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length906
Libraries
Library NameType
IVIA1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig12385 contig Ccv1_Contig12385:56..961. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionIC0AAA12AG04RM1 IVIA1 Citrus clementina cDNA clone IC0AAA12AG04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877795 ID=FC877795|Name=FC877795|organism=Citrus clementina|type=EST|length=906bp
TTTTGCTTTCTTCCTTCGGGATTAATTGTGGTCGCAGCCACAGTGACGGG
GCAACCCCGGCCCGCAACGCGGACAGAGGGAGTACGATCGAGAAGCCAAT
CAGAGAGACGAAAGAGAAGTAGTGGTTGTTATTTCGTATGGCAACCCTAC
TCTCTTTCCTCTCGTCTCTCCCTCTTTCTCATTCATCACCTCCTCAACGC
CGCCGTTTTCCTCCGTCTCCTTCTAATTTCTCTCCTCTTCGCTTCACAGC
GAAAGAACCTCGAAAATCACGAAGCTTAGCCGTGTCTTCATCTTCGGCAT
CGTCGTCATCTCCGTTCGATGATTTCTGCTCAAAACTGAATTCGCCTTTG
CCTGATTCGTCAACTAAGAAATCAGTGCTAGCAAGTATGATACAAGAGGT
AGAACCATTAGATGTGACCCTCATCCAAAAGGACGTTCCACCCACTACCT
TGGATGCCATGAAAAGAACAATCTCAAGCATGTTGGGTTTACTTCCATCT
GATCGGTTTCATGTATTTATAGAGGCTTTGTGGGAACCTCTCTCTAAGTT
ATTGGTGTCTTCAATGATGACCGGGTATACATTGAGGAATGCTGAATATA
GGCTTTGCCTTGAGAGAAATCTTGATGTACATGAAGGAGATGGTGAAAAT
CAAACATCAGAATGTTCCCAAACTGATTTGCATGGGATGTTGCTTAATAG
GGAAAACATTGATGAGTTTTCTGGAAAAAATGAGTTATCATCTGAATTCC
AACAAAATGTTGATGACTTANACGGGGACATTGGTGTTGAAGGCCTTGGT
GAAATGACCCCTGAAGTTCAACAATATATTCTTAATTTGCAGTCTCGTTT
ATCCTCTATTAAAAAGGAACTTTGTGAAGTTAAGAGGAAAAGCTCTGCTC
TTCAAA
back to top