FC877798

Overview
NameFC877798
Unique NameFC877798
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length797
Libraries
Library NameType
IVIA1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC877798_ssr282 microsatellite FC877798_ssr282:282..297.
Ccv1_Contig3016 contig Ccv1_Contig3016:85..902. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionIC0AAA58BG04RM1 IVIA1 Citrus clementina cDNA clone IC0AAA58BG04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877798 ID=FC877798|Name=FC877798|organism=Citrus clementina|type=EST|length=797bp
CTCGTATAAGAGGTCTAAGCGGCATCACTCGAGCTTCATTCGTGGCAAAA
TCAATTGGACTTGTTGCTGGTGTTTTTTCTAGTACCCGCTGTGGGATTCA
GAGATACAGGAAGCAGAATGATTGGATGGGTTGACTTTGGCATGAATTTT
TATGGAGCACAAATTTTTTAAAGCATCAAGCACGGAGTCCCATTAGAGAT
TATTTAGTTGATTCCTGTAGCAATTCTCCTCAACCTGCTATTTCCAATTC
CTTTAGAAGCTAAGGCAGTTACTATTATAACCTCTCTCTCTCTCTCTCAA
CTGTGCTAGCTAATGTTTTGATGTCCTCAAGGTGTTTGTTACTGATTCTT
TGTTGCTGTTTAGATGATAAATTTTAGGTTATACGCACTATGATGCACGT
GGAAATTTGGACATTGTCTGCTAACAAATTGTAGGTGGTTCATAAGGATA
ATACATGTCAATTCTCTGTGAGAGGATTCCGTGATGTAGATTCAAAGCCT
TTTACCTCAATGATGTGGCAGAAAATATGGTACACCCTGGGATGATGAAA
GACTCCTTTTATTTGTGGTTCTTTCATTTTTCCAGTTGAATTATTTGTTT
TCTGCCGCCAGCTAAATGCTTGCAATTTAATAAGATTGTATTTGAAGTCC
ATACAATCTACATGTACAAAGTAGTCAATTACCATTGGTCCCTGACTTAT
TGCGTAGGACAGGAGTGTTTGTTCGTAACAGGAGTTCATGTATCATATAA
TCAGAAATGCGAAAGATTCGATNCACATGATCTTTCTGATGCTTTAT
back to top