FC877801

Overview
NameFC877801
Unique NameFC877801
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length810
Libraries
Library NameType
IVIA1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC877801_ssr314 microsatellite FC877801_ssr314:314..325. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig6008 contig Ccv1_Contig6008:1..810. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionIC0AAA58BG05RM1 IVIA1 Citrus clementina cDNA clone IC0AAA58BG05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877801 ID=FC877801|Name=FC877801|organism=Citrus clementina|type=EST|length=810bp
CAGGACATTCCCCAATATCAATTCGATTTGCAGCAAATTCTGATAGATTC
TTTCCCCAACTCAACGGGAGAAAAACTCAGGGAAAGAAACACCCCTTCAC
AGATCTCACTTATTGTCTTAAAAACTCACCTCCCTTTCTCTTTTTCTCTC
TCAGACACAACACACTCTCCTTGTTGTACTTTCAGGAACAATCAATCATT
GCATCCCAAAATTCAAACCACATCCCCATGTAAGATCTCTCCAGTTCGTA
CAAAATTCACAATAAAAGAAAATGGGATCCAATCAGTCCGTCCAAGTACT
TGACGAAGATAGCGAAGAAGAAGAAGACGAAGAGGAAGAAGACGACAATG
ACAATCATAACACTACCGAATTACTAGACAATCAATTAGTGAAGAAAGTT
CTAGAACAGGAACCCGAAATGTTGCCCTGCCACGCGTCCGCATCTCCCTT
GTCCCCCCAGCTCTCCTCCCTGGGAACTCCGCGGCTGGGGCCGTCGATCA
AGGTGTGGGACCCGTACAATGTCTTGGCGCCTCCTCTGACTCCACCCGCC
TCAGTTCTGTCGCGGGGTTCGTTGGCGGACGAGGATCGGAATGTGACGGA
GGTGTTTTTGGTCAGTCACGGGGAGTGTGAGTTGAATTTGAGACCGGATT
TGGTCGGTGGGAGATGCCACGTGGCGAAACTGACGGCTAATGGGAAGAGG
CAAGCTAGGGCATTGGCTGTTTTGTTGCATTCTCAAGGGGTTAGGTTTAA
TGCCGTTTATTCTTCGCCGTTGGATCGGGCTAGATCCATGGCGCTATCTG
TTTGTCAGGA
back to top