FC877887

Overview
NameFC877887
Unique NameFC877887
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length915
Libraries
Library NameType
IVIA1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC877887_ssr282 microsatellite FC877887_ssr282:282..293. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig3466 contig Ccv1_Contig3466:1..915. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionIC0AAA27DH09RM1 IVIA1 Citrus clementina cDNA clone IC0AAA27DH09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877887 ID=FC877887|Name=FC877887|organism=Citrus clementina|type=EST|length=915bp
AGAAAATACGCTCTCGTATTCTCTATACTCGCTCATTCGATGAGGGTAAA
ATTGTGGGTGCAGAACAGTAAATAAATGAAATGAGCTCTCTCAATGCAGT
TGCCTACTTCACGGCTCCACAGCTCTCCTTCTCCACACGACGCCGTTCTC
GCCGTCACCGCCGCCACCTCAGAAACGATAACAATAACAGCAGCGACACT
TATAACCCCCTTTCAAAACCGTCCTCCTTCGACGGCGAAAATATCAATTT
AGTCCTCGACTTTCACCAAATTTCCATTCTGTCCTCCTCCTCCAAATCCA
AGCTTCACCGCTTCCTCTCCTCCGCCGAGCAGGCTTACGCTGACCTTAAA
ACCGTAATCACACTCGATGACAACGGGCGGCTGCTAGTCTCGTGTCGCAA
GTCCACGCTTCAGTTCGTCGGCGGCGTGTTGCTTTCCGGCTTTGTCTTGG
TTTTCGTCTTCAGGGTTTTGGTTAAATTAGGGTTAGGGTTTAGCTCTCGG
TTCCGGATTCAAAAGCAAAACTTTGTTGTTAGGAGAGATAGGAGTCTCGG
CGGGAAAGAAGTTGTGGTGGCCGTGGGAAGGGGAGACGATGATGCGAAGC
TGACCAGGAATTTGAAAAATAGGGTCTTGGACAACCCGTTGTCGGAGGGT
CGGGATGCCGGGTCAGCATTGACCGGTCGGGTCAAGAGGAGTTATCGGGT
CCAGCGGATGAGTGAAGGAAAGTTGCCGAAATGGTGGTCGGTTCAAGTTT
CTGCGGATTGGACTTTGGTGGTGGACAAGGAGGAGTATCAAAGAGAAGCT
AACAGATTAATTAGAGCGATCATTGATCAAAGAACCCGTGGACAGGACAT
TCTGGAGGACGATATATATCGAGATATCTGGAGTGCGGGTATCAATTGAT
ACAATAAACACACGG
back to top