FC877893

Overview
NameFC877893
Unique NameFC877893
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length856
Libraries
Library NameType
IVIA1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC877893_ssr9 microsatellite FC877893_ssr9:9..18. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig12538 contig Ccv1_Contig12538:41..896. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionIC0AAA60DA08RM1 IVIA1 Citrus clementina cDNA clone IC0AAA60DA08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877893 ID=FC877893|Name=FC877893|organism=Citrus clementina|type=EST|length=856bp
CCCGGCGCCTCTCTCTCTCCCGCTCACTCTCACTCTCACTCTCACTCGCA
CGCTCTCACCGTCTCACTCTCTCAGTCCCACTGCCGTCACTTACGCACCA
TCCACCGCCGGCAATCGTGATTCAATTTTTTTTATCAGCTCGCGGCAGAT
CGTGATCGTGATTCACAGTCTCACTAGCTCGCGGCAGTGATCGCCATTCA
TCCACTTCGTCGCAGCCTCGTTCAACCGTTACCATCGCGCCGGCCGCCGG
AGACTGGATTGGTGATGGCTTGTCAAGCACTTAAATTGGAACCAACAAAG
CAAGAGAAGGCTTGCTTGGCAACCTTTAAAAAGAGAAAGAACAGTTTGAT
GAAGAAGGCTTATGAGTTTACAACTCTGTGCGATGTTGAAGTATGCATCA
TCATCTATGGTCCAAAAGTCAAAGGCCACTCTTTGAAGCCAGAGACCTGG
ACCTCAAAGGAAGGTGAATTGACCAGTATTATCAGAAAGTACGAGAAGAA
AATTAGTGCAGTTGATCATGGTCAACATAGAACATTATCCTTGTCTAAAT
TCGACGAAAGTAAGATGAGGCAAGTTGATGATGCAGCTACAAGGGCTTGC
AAGAAAATTTGTGTAGGAGATTTTACTACATGGGATCAAGGTATGGACAG
TTTATCAGAGGATCAACTGAAGATGATTCTCAGCACAATGGATGATAAGC
TCAAAGATGTGGACAGGAAACTAAACATGATCAAAAGAGATCAGAACGTT
GTGAATAAGGCCACATCAAGAAAGTTAGAGCATGACCATTCAAATGATGC
AAAATCACTTGTCAATTTGCAGCCTGCTTATCAGGTTAGTCAAAAGCTAC
CATCTG
back to top