FC877897

Overview
NameFC877897
Unique NameFC877897
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length862
Libraries
Library NameType
IVIA1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig5257 contig Ccv1_Contig5257:1..862. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionIC0AAA49BE07RM1 IVIA1 Citrus clementina cDNA clone IC0AAA49BE07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC877897 ID=FC877897|Name=FC877897|organism=Citrus clementina|type=EST|length=862bp
TGAATGGCACGATGAACGGCGGCACAACTTCTACAACGGTGAACGGCGGC
GCATGAACAACCCCCTGCCCCGCTCACTCAGTCTCACTCTCTCACCTGAC
GCAGGCTTATGGGCAAAAAAAATTCAAAATCCCTAATTACTAATTCCTCT
CCTCTTCTGCTTCCACAACAGTCAACGGCGGCACAACTTCCACAATGGTC
AGCGGCGGATTTGATTTTCAGCCACTAGCCACCACCGACATGCATGAATG
TCCAATCTCTTAGCCGCAATCGATATTCTTTGTCGACGTCGTGAAGAAAT
TGGTTGAGTCGCGAGCATGGAGAAGCACAAGGGGGGAATCACTGGTATCA
TATTATAAAAATGCCATCTGTATAGAACTTTTGGTGTTCACTTCATTGGT
AATTTTTCCCCCTTATTTTGCTCAATTCTTTGAATTATTAAATTATTCTA
TAGATTCCATTTGCAGATTTTTTGAATCACGATGGGCTTTCAGAAGCAGT
TGTGTTGCATGATGAGGATAAACAATTGTCAGAGGTTATTGCTGATCGAG
ATTATGCTCCTAAGAAAAGGTATGGATAACATATGGAAAATTCCCAAATT
CAACCTTGCTATTGGATTTCGGTTTTTCCCTTCCATACAACAGCCACAAT
GAGGGTGCAGCTCTCAGTTTCAAGTACTACCAATATTGTTTCTCTTCCAT
GAACGAATCTGTAGTTTTACCCAGCTATGAACTGAGTTAGCCATCGGTTA
TTAGCAGTTTCTGGACAAGGAGCAAGAAGATACCAATGAGGACCTGGATT
TCAGAAGCAATTCTCTTATTTTTCTTTTATTTTGAATCATTAGCATTTTC
TTTTTCTCGTTT
back to top