FC920174

Overview
NameFC920174
Unique NameFC920174
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length115
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14116 contig Ccv1_Contig14116:166..280. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
RVDevelop1cdna_library
Properties
Property NameValue
Genbank descriptionC32005A02EF RVDevelop1 Citrus clementina cDNA clone C32005A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920174 ID=FC920174|Name=FC920174|organism=Citrus clementina|type=EST|length=115bp
GATTTTCCTACTACTCCTCTCCGTTTTTCTTCGGGGAGCTTCTTCATCAA
TCCTTTCCGAGGACACACCTATTAGCTTCTCATTTCCCTCATTCGCCAAA
GACAGGTGTGACAAT
back to top