FC920177

Overview
NameFC920177
Unique NameFC920177
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length693
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC920177_ssr9 microsatellite FC920177_ssr9:9..18. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig10361 contig Ccv1_Contig10361:2..695. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
RVDevelop1cdna_library
Properties
Property NameValue
Genbank descriptionC32005A05EF RVDevelop1 Citrus clementina cDNA clone C32005A05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920177 ID=FC920177|Name=FC920177|organism=Citrus clementina|type=EST|length=693bp
GCTTGAGTTCTCTCTCTCTTCTCTCTCAAAATCAAAATGGTAGCTCATTC
ATTATCTATTGTGCTTGCTCTCGGCTTGCTCTTGCTCTTATCTGGTCCTG
CATTTGCTGCCAAGTACTTTGAAGGGTACCTCCCAAATGGCGACTTTGAG
GAACTACCAAAACCAACTAACCTCAAAAAGACAGTTCTAGTTGGGAAACA
TGCACTTCCCAAATGGGAAATCAATGGCTTTGTTGAATTCATCGCCGGTG
GGCCCCAACCCGGTGGCATGTTCTTTCCAGTATCTCATGGAGTCCATGCC
ATTAGGCTTGGCAATGAGGCCTCGATCTCTCAAACTATAACTGTAAAACC
AGGAGCCCTTTACGCACTAACATTTGGTGCATCAAGAACTTGTGCTCAAG
ATGAGGCGTTGAGAGTCTCTGTGCCTCCTCAGTCGGGGGATCTGCCTCTG
CAGACATTGTATGATATTAACGGTGACACTTATGCTTGGGGATTTAGAGC
CAAAACTAACATTGTTACAGTGACATTCCACAATCCTGGTGTTCAAGAGG
ATCCTGCTTGTGGTCCACTTATCGATGCTGTTGCTATTAAGGAGCTCTAT
CCGCCAATGCCGACAAGAGATAACTTGGTCAAGAATCCTGGCTTTGAAGA
GGGTCCACATCGGCTAGTAACACTACTAATGGAGTCCTTCTTC
back to top