FC920181

Overview
NameFC920181
Unique NameFC920181
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length674
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14093 contig Ccv1_Contig14093:1..674. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
RVDevelop1cdna_library
Properties
Property NameValue
Genbank descriptionC32005A09EF RVDevelop1 Citrus clementina cDNA clone C32005A09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920181 ID=FC920181|Name=FC920181|organism=Citrus clementina|type=EST|length=674bp
GGGTTTACCGATAATTTCACCTCACTCAAAATCAGCTGATATATGCTTCC
TTAAACGATAACAAGAAGAAAAATCATCTGAACGATGGGTCCGACACAAG
ACCGATCCGAAATCGCGTTCTTCGACGTAGAAACAACGGTTCCGACCCGA
CCTGGCCAGCGCTTCGCCATTTTGGAATTCGGAGCAATTTTAGTTTGTCC
CAAAAAGCTCGAGGAGCTCCACAACTACTCCACTCTGGTCCGACCCGCCG
ACCCGTTGCTTATCTCCTCTCTCTCCGTACGCTGTAACGGCATCACTCCA
GACGCCGTCGTTTCCGCCCCTACTTTCGCCGATATCGCCGATACAGTCTT
CGACATTCTCCATGGAAGGATATGGGCGGGTCATAATATACTGAGGTTTG
ATTGTGCGAGAATAAGAGAGGCGTTTGCGGAGATCGGACTGCCGGCGCCG
GAGCCCAAGGGGACGATTGACTCGTTGGCATTGCTGACGCAGAGATTTGG
AAGGAGAGCTGGTGACATGAAAATGGCCTCCCTTGCAACCTATTTTGGCC
TTGGACAGCAGACTCATAGGAGCTTGGATGATGTACGAATGAATCTTGAA
GTTCTCAAGTATTGTGCAACTGTTTTGTTCTTGGAATCAAGCCTCCCAGA
CATATTCACTGTGAACAGTTGGGT
back to top