FC920385

Overview
NameFC920385
Unique NameFC920385
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length484
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14131 contig Ccv1_Contig14131:1..484. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32007F07EF RVDevelop1 Citrus clementina cDNA clone C32007F07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920385 ID=FC920385|Name=FC920385|organism=Citrus clementina|type=EST|length=484bp
GACGTTAGATCTAAACCTTTTTAGTTTTATTTTTCTGGAATCTTCTCCGG
TTCGTTTCGTGCAGTGAGCCGATCTGATCTCGGGTTTCAGCCATGGACGA
GGAGTTCGAATTTGGTGATAAGGCTCCTCCCTCTTTCGATCGCGTGGGAA
ACACAGTTAAGGATGCTGGAGCCAAAGGGTTCAATCCAGGATTGATAGTG
CTGCTGGTTGTAGGAGGGCTGCTGTTGGTATTCCTCATTGGCAATTACAT
ACTGTACATGTATGCACAAAAGACCCTTCCCCCGAAAAAGAAGAAGCCAG
TCTCCAAGAAGAAGATGAAGAAGGAACGACTGAAGCAAGGTGTCTCTGCA
CCCGGAGAGTAGAAATTTTAGATCCGGTTTTGGTTCTTCTCCTTAAATGT
TGAACATTCAAGTTCGAATTTTTTCTCCAGATTTGGTGTCAAGAGAGTTG
TCGCAAAAAANAAAAAAAAAAAAAAAAAAAAAAA
back to top