FC920389

Overview
NameFC920389
Unique NameFC920389
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length651
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig12445 contig Ccv1_Contig12445:22..672. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32007F11EF RVDevelop1 Citrus clementina cDNA clone C32007F11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920389 ID=FC920389|Name=FC920389|organism=Citrus clementina|type=EST|length=651bp
GAACGATAGGTCGTATTGATCCCGCCACTGGACACTGAGACTGAAAGAGA
ATGGAGCAGGGATCATCGTACGAATCGGACGGACTCAACGGCGTCGGCGT
CGGCGTCGGCGTCCCCGTGGACGACGATGACGCTACCAAAAAATATAAAG
GGATCCCCTGTGATGACGAGACACTCTACGGTGTTATCCACCGTATGTTT
ACCATGATTCTCTTCCCCGATTCCAACAGCCGCGTTGCGTCGTTTTCTCT
GCTGCGCCGGATCAAGATCTCTCTATCGGAGAATGGATCGCACCTTCGCC
AAGCTTCTAGAAACACCGGCCGGAAAGTTCTTCTCTGGACCCGTAGAGGG
AGTCCTATCCGTGCTCTCTTCGTCATCTCCGTTGGGACAATTACTCTTCT
TACCTTGACAGGGTTGCTTGTATTTATGCTTTTCTTTCTGGCTGCAACTA
TCAACGCAATTATCATTTCCCTTCTCGTGTCTTTGGCTGCAGCAGGAGGC
TTTTTGGCACTTTTCTTTGCTTGTTTAACTGCTATTTATATTGGGGCTTT
ATCCGTTGCTGCTTTTGTTATTTCTGCTGCAACAGTTTCTGCAATTGTGG
CTGTTTTGATCGCATCAGGCTGGATAGGGTTCTTCTGTGTTATTTGGTTG
G
back to top