FC920391

Overview
NameFC920391
Unique NameFC920391
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length679
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig8350 contig Ccv1_Contig8350:103..781. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32007G01EF RVDevelop1 Citrus clementina cDNA clone C32007G01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920391 ID=FC920391|Name=FC920391|organism=Citrus clementina|type=EST|length=679bp
GNGGGTTTCGAAACGCATTACAGGCCCCACTTCATCACACCCATTATCTG
ACCATCCACCAAAACCCACCTCATTCCTCCTCCCAAAATCCCAACAAGAG
GAGGAAACCAGAACAAGGAAACGCATCGAAGCGATGCCTCAAGAAACGCA
GCCCGAAACGCCTCCTAATTACTGGGGCTACATGCCGGAAGAGGAGTACT
ACACGTCTCAGGGAGTGCGAAACGGTAAAGAGTACTTCGAAACGCCCAAC
GGGAAGCTCTTTACGCAGAGTTTCCTGCCGTTGGATCAAAAGGTGAAGGC
CACGGTGTACATGACCCACGGCTATGGATCGGACACCGGCTGGATGTTTC
AGAAGATTTGCATCAGCTATGCTACGTGGGGCTACGCTGTCTTTGCCGCT
GATCTTCTTGGACACGGCCGATCGGACGGCATACGTTGCTATCTAGGTGA
CATGGAGAAGGTCGCTGCTTCGTCCCTATCATTCTTCAAGCATGTGCGCC
ACAGCGAACCATACAGGGACTTGTCCGCTTTCTTATTTGGCGAGTCCATG
GGTGGGGCCGCAACAATGCTGATGTACTTCCAGTCAGAGCCCAATACGTG
GACGGGTCTGATCTTCTCGGCCCCACTCTTCGTCATCCCAGAAAACATGA
AACCTAGTAAGCTCCATCTCTTCATGTAC
back to top