FC920396

Overview
NameFC920396
Unique NameFC920396
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length408
Libraries
Library NameType
RVDevelop1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC920396_ssr220 microsatellite FC920396_ssr220:220..234.
FC920396_ssr187 microsatellite FC920396_ssr187:187..198.
Ccv1_Contig14133 contig Ccv1_Contig14133:1..409. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC32007G07EF RVDevelop1 Citrus clementina cDNA clone C32007G07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920396 ID=FC920396|Name=FC920396|organism=Citrus clementina|type=EST|length=408bp
AACAGCGATGAATAAATCCCTTGGGCTCTCTCCCTCCCCTTTACTCAACC
CCCACCAACTTCCCTCTTCTCTTCTTTAATACATAACCAAATTGAAAGAC
CAGACTCTCCTTCTTCATCTCAACTTAAAAAACCCAAAATTATTATTAAA
AAAAAAGAACTTTTTTTTTCTTTTTTAAATCTGTCTCTCACTCACTCAAT
TCATCTGTCGATTGAGTGAGAGGAGGAGGAGGAGGGGAGCTTCTTTAATT
TATGTCCTTATTAGATGCTTGTTTTGTTTTGAGTCCATAACTTGTTTGTG
CGTACAAGTTGGGGGAGGAGCTGGAGAGAGGATGAAGCTGAGGATGATAA
AGATCTTATATTATATGTATTAAGCTACGGATAATTTTGGTGGGTTTTTG
AGATTTCG
back to top