FC924878

Overview
NameFC924878
Unique NameFC924878
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length438
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig3640 contig Ccv1_Contig3640:16..453. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP6YM09FM1 TF Citrus clementina cDNA clone KN0AAP6YM09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC924878 ID=FC924878|Name=FC924878|organism=Citrus clementina|type=EST|length=438bp
TTCAAGCATCATATAATCAACTGTTTGTTCCAATCTTTCATAAGAATCCG
AAAATGGCTGGATCCGGTGGAAGTGTTCCTGCTCAGGCTACTGATTTCTC
CTATGAAGGTGACAATAAGAATGTTATCGCCGAGAGCCTTGAAGTAGTTC
CTGAAGTTGCACCAGAGAAAGTGAACGAGGGAGACGACAACGGCGGCTGC
AAGTGCAACCCATGCAACTGCAACCCGTGTAACTGCAGCAAATGAGAGAC
AGATGCGCCATGCGGCCTATGGAATTAATTAACCAGCTGCCTGTTTAAAA
GCATATATATGGATCTTTTTTAAATAAGAACTAATATAGAATCTAATACC
TATGTTTGCTTCTGCTTCAATGGCTTTCTTGTGAACGTTTGTAAAATATA
GAATAGACTACAGTTCTACGTACAAGTCTCTGCTTTGA
back to top