FC924892

Overview
NameFC924892
Unique NameFC924892
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length732
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
FC924892_ssr164 microsatellite FC924892_ssr164:164..178. BLAST: Citrus ESTs to Prunus persica proteins V1
Ccv1_Contig4749 contig Ccv1_Contig4749:89..820. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
TFcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAP1YL07FM1 TF Citrus clementina cDNA clone KN0AAP1YL07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC924892 ID=FC924892|Name=FC924892|organism=Citrus clementina|type=EST|length=732bp
CACAAAGCCAGAGAGGCCAGAGCTTCTCCAAAGCTCAGCAAAAAAAACTC
TTATATGGCGTCAGCTCGAGCTTTCACTCTCTCTCGCATCACCACCAGCA
CCAATACCAACACCGACGCGTCATTCAATCCTCTCCACCTCCATCGCGCG
CCGTTTTCCCGCAACCACCACCACCACCACGACGTCATCCGCTGGCCGAC
GAGACGGGGCCTTCTCTCCGCCTCATATTCCGCAACCGTCAGTTGCCTCA
GCAGCGGCGGCGGAGTCTCCAACGACGACTTCGTTTCGACGCGGAAGTCA
AACTTTGACCGTGGATTTCGGGTGATTGCGAATATGCTCAAGAGAATCGA
GCCGCTGGACAATTCTGTTATTTCCAAGGGAATTTCTGAGTCCGCTAAGG
ATTCCATGAAGCAGACCATTTCTAGTATGCTGGGTCTGCTCCCATCCGAT
CAATTCTCCATCACCGTTAGGCTTTCCAAACAACCTCTGCATTCTCTTCT
CGTCTCTTCGATCATCACAGGGTATACGTTGTGGAATGCCGAATACAGGA
TTTCGTTGATGAGGAATTTTGATATATCTGTGGATGGTTTAAAAAGGTTG
AACTTTTCTGTAGAAGGTGAGGTTTTGGACAAGCATTGCGAAGAGAGTGA
GAATGAGGGTGGTGAGATTAGTGTTGAAGATTTGGAGATTAGTCCTCAAG
TTCTTGGGGATTTGTCTCATGATGCTTTGAAC
back to top