FC928838

Overview
NameFC928838
Unique NameFC928838
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length787
Libraries
Library NameType
PhII-IIIV1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionKN0AAH3AH04RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH3AH04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928838 ID=FC928838|Name=FC928838|organism=Citrus clementina|type=EST|length=787bp
TAACTACTTTCGAACTTTGATTCCCGTAAGCAGAGATCTTTCTGATTTGA
AGAACATGGAAACCACCTGCGCAGGTAATAACTGGTCAGAGGGTCTTCTG
CTTCCTCCGTTTGGCAGTATTGCTGATGATGATGTCATGAACGACAATCT
TGATTTTCTTAATGTCCCCCAATATGGAAGAAACCCCGACTACATGGGTT
AAGTGCAGCACTGCTTTTTTTTTTTTTCTGTTTTGTTTAATTAAATAAAT
GATAGGTATACTATTACCTATCAATCATGACAATGTTTTAGTATGGTTTA
GTTCAACTTATAAGATTTCTTGAGACGTACAAGCAATCTTTTTGTTTACT
TTTGAGCTAAGTATTTTCCTGAAAAAGGAAATAAATCAATAAAAGTTATT
GTGTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGACCTCGTGCCG
AATTCGGCACGAGGGTTGTTGTATGGAGATTTTGATAGATTGAAGGATAC
TTTGTGGTGATTAACACAATGGGAGGGCTTTGCTCGAGGAGTTCAAATGT
AGATAATGCTCCCGGTGAAAGCTTTCCAAGTGTTAATGGTCATTTTGGTT
TGGTTTATCAGCCGCGTGAACTGCCCATGAAAGTGAATAACAATTCAACT
CCCTCTCCCGTAGGGGAGAATGTGGAGAATAAGGAATTGACAGAACCGTT
TTCCTTTCCCACGGTCAATGCTATTGCTGCTTATGGGACTAATCTTGAAG
ATATCAATGATGGGATTCCCCGCTTGCCAAGGGCTCT
back to top