FC928841

Overview
NameFC928841
Unique NameFC928841
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length705
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9253 contig Ccv1_Contig9253:2..706. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH3AH07RM1 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH3AH07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928841 ID=FC928841|Name=FC928841|organism=Citrus clementina|type=EST|length=705bp
ATTATGCATAGCAGATTACTCTGTAAATTGAGAGTTTTGCTGCTCTACCC
TCAGATACCAATCGCAAATTTTTGCATTCAAAATGTGAATACATTGAAAT
TGGTTTTGTGATCTTGTATGCTGAGTGAGCCATAAGAATGCATTTGGAAT
ACTGGTGGATTTGAAGACTCTTCTGCCTGATGAATGGCTTTTCTTCACTC
ACTTAATTACAAATGTAAATTAAAAATAAAAGAATACCCTAATTGAGCTA
CAAATTTGGCCTCACCTACTTAACTCTCTTGACTTCAAGCATTCGAGTTT
TATTATTACATACATATTCACTGCAGCTAATTTTTCTTATAATATTCCAG
GAACCTGAGATATTTAGTTAGAACGGAACATTATGCTTTATGCAAGCATG
AAGTTTTGATTGATATGAAATATGATGGAAATGACTCAGCATTAACTCTT
AACTTGTCATTGTTCACTTGGACTACCACGGAAACTGACTATGACTTCCC
ACTTACAAGAAGCGAAGCATTATTTTTGCAGAGTGCACAAAGTATGGCGT
TTGTTCCATGACCACGCTCATGATCTGTGGGACTCTCTGGTCCATACTTC
TTGCTTGCTTTGGGTTTTGCCCGGACAAATAATGTTTGAAGTATCTGTCA
TAAGTGTGCGGGGTTGCTCCTTGGCTGCAACCATATGCTAAAGAAATGTT
CTCAT
back to top