FC928848

Overview
NameFC928848
Unique NameFC928848
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length738
Alignments
Feature NameTypeLocationAnalysis
FC928848_ssr81 microsatellite FC928848_ssr81:81..92.
FC928848_ssr491 microsatellite FC928848_ssr491:491..502.
Ccv1_Contig15036 contig Ccv1_Contig15036:17..754. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1CA02RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1CA02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928848 ID=FC928848|Name=FC928848|organism=Citrus clementina|type=EST|length=738bp
GGCACGAGGGAGGGACTGCTATGATAGTTAACACCAACCCAAGCACTGGT
TCTTGTGTTTTTCCATCGTCATCTTCTTCTTCATCATCATCAGCACCACC
ATCACCACCAACATCAGCATTAACACCGCCAGCTCAGCCATCTTCTACTA
CACCTCCAGCTACCACAACTGCACCACCAGGTACCACAACTTCACCACCA
GGTACCACAACTTCACCACCAGTGACAACGTCTCCAGCGCCAGGGACGTC
AGGCTCTGTTGCTCCACCTGGAGTGTTAAATTCAAGCAACCCTGCATCAG
GTTTCGGGTCCGATAGCCCTCCAGTTGTTAACACATCAACATCAGCTGGG
TCACAACTCATTCTTAGTTCCCTCACTTTGGTAACACCCTTTGTTATTAG
ACTAATTATCCAACAAATATAGAAACAAAAGCACTTGTCCATGTACATGA
ACCGGTCAGAAGCACCAGCTTCAGTTGAAGGATCAGAGTTGCAGCAGCAG
CAGTAGCAGTTCGCTTCAAGCAGTGTACAGAGGCACTTTTGCAGGAAGCA
AACAAGGCTGAATGATAGTTAGCACCACACCAAAGATGTTAAATTAGATG
CTAACTGGCCTGCTTGAGCTTGTTCCAGATGTAGAGACGTTCAGTATTTA
AGGTAGAAAACTTAGTTTCTACCTGAAACATATAATGCTCTATGTTTAAT
ACTAGGCTACTTTTTGAACAAAAAAAAAAAAAAAAAAA
back to top