FC928849

Overview
NameFC928849
Unique NameFC928849
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length888
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig11759 contig Ccv1_Contig11759:9..896. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1CA03RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1CA03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928849 ID=FC928849|Name=FC928849|organism=Citrus clementina|type=EST|length=888bp
TGGATTCAACCGGAATCCGCCGCAGTTTCCGGCGGGATGATAGGAAGCAA
GGCGGCACAGCCGAATCAAGCACAGACGACATTGTGCTCACTCCGAAGCT
CGCTTCTTACTTTAGCACTTGTAACCCTACTCTGCTTCACTTGTCTCTCC
TTCAATTCCTTTCGCTCTTACCCTCTACAAAACAACTTCAACTCAACTCT
CTCTTTTGCCATAAACAAACAAGATTATTCGGATTTAGGCTCTGATGTTT
TCCACTCGCCCAGCGTCTTCCACTTGAATTACTTGGAAATGGTGACAAAT
TTCAAGATCTATATATACCCAGATGGTGATCCCAATACATTTTATCAAAC
CCCAAGAAAATTGACCGGAAAATACGCCAGCGAAGGCTATTTCTTTCAGA
ATATTAGAGAGAGTCGCTTCTTGACTCATGATCCCGATCGAGCCCACTTG
TTCTTCATCCCCATTTCCTGCCACAAAATGCGCGGCAAGGGAACTTCTTA
CGAGAATATGACAGTAATCGTTAAGGATTACGTGGACAGCTTGATCAACA
AGTATCCTTATTGGAACAGAACTTTGGGTGCGGATCACTTCTTTGTAACT
TGTCATGATGTAGGTGTGAGGGCAACGGAAGGAGTTCCGTTTCTCATTAA
GAATGCAATTCGAGTTGTATGCTCTCCTAGCTATGACGTTGCTTTCATTC
CACATAAAGACGTTGCTCTGCCTCAAGTACTGCAGCCATTTGCTCTTCCC
CGTGGAGGACGTGACGTTGAAAACAGGACCGTTCTTGGTTTTTGGGCTGG
TCACCGTAACTCTAAAATTAGAGTTATCTTGGCTCGTGTATGGGAGAATG
ACACAGAACTTGACATTTCAAACATAGAATTAATAGGG
back to top