FC928852

Overview
NameFC928852
Unique NameFC928852
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length757
Libraries
Library NameType
PhII-IIIV1cdna_library
Alignments
Feature NameTypeLocationAnalysis
FC928852_ssr160 microsatellite FC928852_ssr160:160..171.
FC928852_ssr234 microsatellite FC928852_ssr234:234..253.
Ccv1_Contig9295 contig Ccv1_Contig9295:11..767. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAH1CA06RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1CA06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928852 ID=FC928852|Name=FC928852|organism=Citrus clementina|type=EST|length=757bp
GGCACGAGGCCCAGGCCGAGCCAAGCACCAATCTTTTTGTCTCCGGTACT
ATTAAAAATCTTTCCTTTTCATTTCGTTTTTGCCTTTTTTTTTAATCAGT
AATTTGTTTATCTTTCTAAATTCATCTTTTTGTTTTGGTCATTTTGTTTG
GACTGTATGTTGTTTGTTTGTAGTTCTCATGGAAACTGATTTTCCTGAGT
GCGATTGTTATTTCAAGATTAGGTGTCAGAACTTTTATTTATTTATTTAT
TTATTTGGAAAAATTTGGAATCAATTCAACTGGTTGCTTGGGAATTGATG
TTGGCTCTATTTAGTTTATGTGATTAGGGTATGTTTGGAATTGAGGTGAT
TTTGACTTTTAATTGCTAGCTGTCACGAATAAGTAGGTCGATCCATTGGC
ATTACTAATTAACAATTGAAATTGGTGTTGAACTACTAGTAAATTATTTA
TGATCAAATAAATGTCCATGTATACGCCTATTCATCCAAACAATAAAAGT
ATTTCTATAATATGGAGTTTTATGGCAACTTAGTTTGATTTTCTTTCTTT
GATTTTTAGTACAATGTAGTCATTTTGGTTGTGTTTTCCATGATTTCTGA
ATTTAGTGGCCAATGTCGGTGTTTATTGTTCTGCTTTGTTTAGATATTTA
GGCATGAGGTATCTACATAGCAAATTAGTTGTCGATTTTACTGTTGTAAA
CTCTATAAGCTGGTTTCATATTTTTATCTTTTTTCTTTGATAACTGTGGG
GAAAATA
back to top