FC928854

Overview
NameFC928854
Unique NameFC928854
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length520
Alignments
Feature NameTypeLocationAnalysis
FC928854_ssr133 microsatellite FC928854_ssr133:133..144.
FC928854_ssr270 microsatellite FC928854_ssr270:270..281.
Ccv1_Contig15008 contig Ccv1_Contig15008:1..520. Citrus clementina Unigene version 1.0 (Ccv1)
Libraries
Library NameType
PhII-IIIV1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAH1CA09RM2 PhII-IIIV1 Citrus clementina cDNA clone KN0AAH1CA09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC928854 ID=FC928854|Name=FC928854|organism=Citrus clementina|type=EST|length=520bp
AAACTCTTAGCAATGAGTTACCATCCTGTTCCTCATGATTCTCCTTGTCC
CCCTCCAGGGCAGCCACCGTCACCATATCCTCCACAGCCAGACTTTCCAC
CCCCACAGCCGCCAGTGGGGCAGCCATTTCCTCCACCACCACCACCTGGC
TATCAGGGATACTTCAATGAAGTGTACCCTCCACCACCACCGGCTCCACA
GCCTTCGCAGGACGATCACCAAAATGACACTGGATGCTGTTCATGCCTGA
AGGGATGTTTGGCTGCACTCTGCTGCTGCTGTGTATTGGAGGAATTGTGC
TTCTAGGCCTTGCATGATTCTTCTCACTGGTTTTATGTGTGTTTTTTGTT
ACTTTTACTGGGATATTTCAGACAATTATGAACGACAGTAGAAAATAGTA
TTTACACATCCTTTAGGGACGCCAAAATGTTAAAATCAAACTTGTGTTGT
TACAAACTGTCAATTTGAACTGTTGTACATTTGCATCTGTTAAAAAAAAA
AAAAAAAAAAAAAAAAAAAA
back to top